AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:




Precursor Sequence:


Genome Location:Chr3:26130554..26130534
Precursor Coordinates:_
Plant Homologs:


Target Start:1764 
Target End:1784 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:154 
Target End:173 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGGCCGAAGGAGGUACGG -5' 
Inhibition Type:Translation 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:2700 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Translation 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:564 
Target End:583 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1509 
Target End:1528 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:111 
Target End:130 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:801 
Target End:820 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGUUCUUG -5' 
Inhibition Type:Cleavage 
Target Start:10 
Target End:29 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGUUCUUG -5' 
Inhibition Type:Cleavage 
Target Start:1250 
Target End:1270 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1256 
Target End:1276 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1523 
Target End:1543 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1637 
Target End:1657 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:209 
Target End:229 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
Target Start:270 
Target End:290 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
Target Start:423 
Target End:443 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGUU -5' 
Inhibition Type:Cleavage 
Target Start:503 
Target End:523 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
Target Start:887 
Target End:907 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
Target Start:40 
Target End:60 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
Target Start:1120 
Target End:1141 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAAAG -5' 
Inhibition Type:Cleavage 
Target Start:1501 
Target End:1522 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGAAG -5' 
Inhibition Type:Cleavage 
Target Start:1858 
Target End:1879 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAAAG -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
Target Start:549 
Target End:569 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
Target Start:19 
Target End:39 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAGG -5' 
Inhibition Type:Cleavage 
Target Start:1428 
Target End:1448 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUA -5' 
Inhibition Type:Cleavage 
Target Start:3583 
Target End:3604 
Target Aligned Fragment:3'- AGGUUUCACUAGAGUASCUAAG -5' 
Inhibition Type:Cleavage 
Target Start:248 
Target End:268 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
Target Start:248 
Target End:268 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
Target Start:248 
Target End:268 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
Target Start:40 
Target End:60 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
Target Start:1122 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1503 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
Target Start:1860 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
Target Start:549 
Target End:569 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
Target Start:1428 
Target End:1448 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUA -5' 
Inhibition Type:Cleavage 
Target Start:20 
Target End:39 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAG -5' 
Inhibition Type:Cleavage 
Target Start:3585 
Target End:3604 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCACUAGAGUASCUA -5' 
Inhibition Type:Cleavage 
Target Start:39 
Target End:60 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAGA -5' 
Inhibition Type:Cleavage 
Target Start:1122 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1503 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
Target Start:1860 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
Target Start:1427 
Target End:1448 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAGA -5' 
Inhibition Type:Cleavage 
Target Start:549 
Target End:569 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
Target Start:925 
Target End:946 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUAAA -5' 
Inhibition Type:Cleavage 
Target Start:19 
Target End:39 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAGG -5' 
Inhibition Type:Cleavage 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:2700 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Translation 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:424 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:664 
Target End:683 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
Target Start:853 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
Target Start:853 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
Target Start:577 
Target End:597 
Target Aligned Fragment:3'- GGCUCGGUUUGGUUAGAGUGG -5' 
Inhibition Type:Cleavage 
Target Start:1298 
Target End:1318 
Target Aligned Fragment:3'- UACUUGGUUUGGUUUUCGUGG -5' 
Inhibition Type:Cleavage 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCAC-3' 
Target Aligned Fragment:3'- GACUCGGCUUGUUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:991 
Target End:1011 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:955 
Target End:975 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1027 
Target End:1047 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1027 
Target End:1047 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1075 
Target End:1095 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1021 
Target End:1041 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1078 
Target End:1098 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1078 
Target End:1098 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1006 
Target End:1026 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:781 
Target End:801 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
Target Start:1508 
Target End:1528 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
Target Start:662 
Target End:682 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
Target Start:662 
Target End:682 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
Target Start:110 
Target End:130 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
Target Start:564 
Target End:583 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:290 
Target End:310 
Target Aligned Fragment:3'- GUUGUCUUCGCUCACUCGAGU -5' 
Inhibition Type:Translation 
Target Start:474 
Target End:493 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:459 
Target End:478 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACAUACACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:1330 
Target End:1349 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACACACAU -5' 
Inhibition Type:Cleavage 
Target Start:28 
Target End:47 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ASACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACAUACAC -5' 
Inhibition Type:Cleavage 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACAUACACACACGCACAC -5' 
Inhibition Type:Cleavage 
Target Start:2168 
Target End:2187 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- CUACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:1587 
Target End:1606 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- UCACACACAUACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACGCACACACACAG -5' 
Inhibition Type:Cleavage 
Target Start:1243 
Target End:1262 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACAUACACACAUAA -5' 
Inhibition Type:Cleavage 
Target Start:4074 
Target End:4093 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- AUAUAUACACACACACAUAC -5' 
Inhibition Type:Cleavage 
Target Start:2155 
Target End:2174 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACGCGUACACAUACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- AUGUACACGCACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:758 
Target End:777 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACAUACACAUACACAUACAU -5' 
Inhibition Type:Cleavage 
Target Start:10 
Target End:29 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACGAACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:156 
Target End:175 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- CCACACGUACACACAUACAC -5' 
Inhibition Type:Cleavage 
Target Start:407 
Target End:426 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACGCAAACACACAUACACAC -5' 
Inhibition Type:Cleavage 
Target Start:1580 
Target End:1599 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- GUACACAAACACACACACAC -5' 
Inhibition Type:Cleavage 
Target Start:187 
Target End:206 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACAUAUACAUAUACACAUAC -5' 
Inhibition Type:Cleavage 
Target Start:343 
Target End:362 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACAUAUACAAACACAC -5' 
Inhibition Type:Cleavage 
Target Start:3931 
Target End:3950 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- CCACACGCACACGCACAUAU -5' 
Inhibition Type:Cleavage 
Target Start:1596 
Target End:1615 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- AAACACACACCCACACACAC -5' 
Inhibition Type:Translation 
Target Start:1777 
Target End:1796 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACAUACCCACAUGCACAC -5' 
Inhibition Type:Translation 
Target Start:1056 
Target End:1075 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACAGACAUGUAC -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:367 
Target End:388 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:310 
Target End:331 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:2341 
Target End:2362 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:367 
Target End:388 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AGAACGAGUUUACUGACAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:343 
Target End:364 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:340 
Target End:361 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:148 
Target End:169 
Target Aligned Fragment:3'- AGGACGACUCUACUCAUAAGGU -5' 
Inhibition Type:Translation 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AAAACGAGUUUACUCGCAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:973 
Target End:994 
Target Aligned Fragment:3'- AGGACGAGUUCACUCUUAAGGU -5' 
Inhibition Type:Translation 
Target Start:322 
Target End:343 
Target Aligned Fragment:3'- AGAACGAGUUUGACUAUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:232 
Target End:253 
Target Aligned Fragment:3'- AGAACGAGUUUGACUAUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:339 
Target End:358 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUC-3' 
Target Aligned Fragment:3'- AGAAGGAGUUUACUCAAAAG -5' 
Inhibition Type:Cleavage 
Target Start:612 
Target End:631 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:81 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:168 
Target End:187 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:93 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAU -5' 
Inhibition Type:Cleavage 
Target Start:81 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGRAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:93 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAU -5' 
Inhibition Type:Cleavage 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:63 
Target End:82 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:822 
Target End:841 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:453 
Target End:472 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCAUAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:1719 
Target End:1738 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- GCGCUCACAGAAGUGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAU -5' 
Inhibition Type:Cleavage 
Target Start:579 
Target End:598 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGYGGAGAU -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAU -5' 
Inhibition Type:Cleavage 
Target Start:87 
Target End:106 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCACACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAUGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:66 
Target End:85 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:60 
Target End:79 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCGCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
Target Start:1764 
Target End:1783 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACAUACGGA -5' 
Inhibition Type:Cleavage 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACAUACGGA -5' 
Inhibition Type:Cleavage 
Target Start:1596 
Target End:1615 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACAUACGGA -5' 
Inhibition Type:Cleavage 
Target Start:300 
Target End:319 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGG -5' 
Inhibition Type:Cleavage 
Target Start:1302 
Target End:1321 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGG -5' 
Inhibition Type:Cleavage 
Target Start:1611 
Target End:1630 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGG -5' 
Inhibition Type:Cleavage 
Target Start:58 
Target End:78 
Target Aligned Fragment:3'- CGGAUCGAGGGAUGAACGGUG -5' 
Inhibition Type:Cleavage 
Target Start:611 
Target End:631 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:83 
Target End:103 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:80 
Target End:100 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:167 
Target End:187 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:83 
Target End:103 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:92 
Target End:112 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAUU -5' 
Inhibition Type:Cleavage 
Target Start:80 
Target End:100 
Target Aligned Fragment:3'- ACGCUCACAGRAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:92 
Target End:112 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAUU -5' 
Inhibition Type:Cleavage 
Target Start:74 
Target End:94 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:62 
Target End:82 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:74 
Target End:94 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:821 
Target End:841 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:452 
Target End:472 
Target Aligned Fragment:3'- ACGCUCAUAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:83 
Target End:103 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:83 
Target End:103 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:1718 
Target End:1738 
Target Aligned Fragment:3'- GCGCUCACAGAAGUGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:83 
Target End:103 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAUU -5' 
Inhibition Type:Cleavage 
Target Start:578 
Target End:598 
Target Aligned Fragment:3'- ACGCUCACAGAAGYGGAGAUU -5' 
Inhibition Type:Cleavage 
Target Start:83 
Target End:103 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAUU -5' 
Inhibition Type:Cleavage 
Target Start:86 
Target End:106 
Target Aligned Fragment:3'- ACGCACACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:50 
Target End:70 
Target Aligned Fragment:3'- ACGCUCACAGAUGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:65 
Target End:85 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:59 
Target End:79 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:50 
Target End:70 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:74 
Target End:94 
Target Aligned Fragment:3'- ACGCGCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
Target Start:40 
Target End:61 
Target Aligned Fragment:3'- AAGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
Target Start:1122 
Target End:1142 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1503 
Target End:1523 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
Target Start:1860 
Target End:1880 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1525 
Target End:1544 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGA-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACA -5' 
Inhibition Type:Cleavage 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGA-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACA -5' 
Inhibition Type:Cleavage 
Target Start:473 
Target End:493 
Target Aligned Fragment:3'- UGGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
Target Start:1428 
Target End:1449 
Target Aligned Fragment:3'- UAGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
Target Start:20 
Target End:40 
Target Aligned Fragment:3'- UAGGUUUCCCUAUCGU-ACUAG -5' 
Inhibition Type:Cleavage 
Target Start:3585 
Target End:3605 
Target Aligned Fragment:3'- UAGGUUUCACUAGAGUASCUA -5' 
Inhibition Type:Translation 
Target Start:1971 
Target End:1991 
Target Aligned Fragment:3'- UAGGUUUCUCUAUAGUAGCUG -5' 
Inhibition Type:Cleavage 
Target Start:1867 
Target End:1887 
Target Aligned Fragment:3'- UAGGUUUCUCUUGGGUAAUUG -5' 
Inhibition Type:Cleavage 
Target Start:1867 
Target End:1887 
Target Aligned Fragment:3'- UAGGUUUCUCUUGGGUAAUUG -5' 
Inhibition Type:Cleavage 
Target Start:5910 
Target End:5930 
Target Aligned Fragment:3'- UAGGUUUCUCUAUAGUAGCUG -5' 
Inhibition Type:Cleavage 
Target Start:607 
Target End:626 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAAGG -5' 
Inhibition Type:Cleavage 
Target Start:553 
Target End:572 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAAGG -5' 
Inhibition Type:Cleavage 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:589 
Target End:608 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:589 
Target End:608 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:568 
Target End:587 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:2700 
Target End:2720 
Target Aligned Fragment:3'- GGGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Cleavage 
Target Start:403 
Target End:423 
Target Aligned Fragment:3'- GAGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
Target Start:236 
Target End:255 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAACCUGGUUCGAAGUAAGA -5' 
Inhibition Type:Cleavage 
Target Start:7 
Target End:26 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAGUUUGGUCAGAGGUAAGG -5' 
Inhibition Type:Translation 
Target Start:1318 
Target End:1337 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GGGCCUGGUUUGAACUAAGG -5' 
Inhibition Type:Cleavage 
Target Start:380 
Target End:399 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAGCUUGGACAGAAGUAAGG -5' 
Inhibition Type:Translation 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACG -5' 
Inhibition Type:Cleavage 
Target Start:645 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUU -5' 
Inhibition Type:Cleavage 
Target Start:645 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUU -5' 
Inhibition Type:Cleavage 
Target Start:618 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACG -5' 
Inhibition Type:Cleavage 
Target Start:528 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACG -5' 
Inhibition Type:Cleavage 
Target Start:24 
Target End:44 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUUCACGU -5' 
Inhibition Type:Cleavage 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GUCUUUUCGUCCUGUGCACU -5' 
Inhibition Type:Cleavage 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GUCUUUUCGUCCUGUGCACU -5' 
Inhibition Type:Cleavage 
Target Start:95 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACG -5' 
Inhibition Type:Cleavage 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GCCUCUUCGUGCUGUGCACU -5' 
Inhibition Type:Translation 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUCUACU -5' 
Inhibition Type:Cleavage 
Target Start:2739 
Target End:2759 
Target Aligned Fragment:3'- ACCUCUUGGUCCCGUAAACGU -5' 
Inhibition Type:Cleavage 
Target Start:1092 
Target End:1111 
miRNA Aligned Fragment:5'-UGAAGCUGCCAGCAUGAUCU-3' 
Target Aligned Fragment:3'- ACUUUGAUUGUCGUACUCGA -5' 
Inhibition Type:Translation 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:424 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:663 
Target End:683 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
Target Start:852 
Target End:872 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
Target Start:852 
Target End:872 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
Target Start:1060 
Target End:1080 
Target Aligned Fragment:3'- UUUUAGAACUAGUAUGAGGUG -5' 
Inhibition Type:Cleavage 
Target Start:1570 
Target End:1590 
Target Aligned Fragment:3'- UUUUAGAACUAGUAUGAGGUG -5' 
Inhibition Type:Cleavage 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
Target Start:1038 
Target End:1058 
Target Aligned Fragment:3'- AACCUGACUUACCUUGGAGGA -5' 
Inhibition Type:Translation 
Target Start:2881 
Target End:2901 
Target Aligned Fragment:3'- UUCGAGUUCUUCUUGUUGUGG -5' 
Inhibition Type:Cleavage 
Target Start:65 
Target End:84 
miRNA Aligned Fragment:5'-AAGCUCAGGAGGGAUAGCGC-3' 
Target Aligned Fragment:3'- AUCGAGUCCUCCCUAUCUUG -5' 
Inhibition Type:Cleavage 
Target Start:181 
Target End:201 
Target Aligned Fragment:3'- UUCGAGUCCUCCUUGUCAAGG -5' 
Inhibition Type:Cleavage 
Target Start:214 
Target End:234 
Target Aligned Fragment:3'- ACACAAGAGUYCAACGGGGAC -5' 
Inhibition Type:Cleavage 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
Target Start:24 
Target End:45 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
Target Start:317 
Target End:336 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- UCACGAGAGCUCAGCGGGGA -5' 
Inhibition Type:Translation 
Target Start:241 
Target End:260 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- ACACAAGAGUUUAGGGGCGA -5' 
Inhibition Type:Cleavage 
Target Start:849 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
Target Start:1620 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
Target Start:438 
Target End:457 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGA -5' 
Inhibition Type:Cleavage 
Target Start:915 
Target End:934 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGA -5' 
Inhibition Type:Cleavage 
Target Start:963 
Target End:982 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGA -5' 
Inhibition Type:Cleavage 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGM -5' 
Inhibition Type:Cleavage 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:320 
Target End:340 
Target Aligned Fragment:3'- AUUAAGAACUACGACGACGUG -5' 
Inhibition Type:Cleavage 
Target Start:14 
Target End:33 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUUAGAACUACUAGGACUA -5' 
Inhibition Type:Cleavage 
Target Start:1658 
Target End:1677 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUUAGAAGAACUACGACGG -5' 
Inhibition Type:Translation 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:516 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGU -5' 
Inhibition Type:Translation 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:263 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:863 
Target End:882 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGU -5' 
Inhibition Type:Translation 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGU -5' 
Inhibition Type:Translation 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:3402 
Target End:3421 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGAGGAAUUACGACGU -5' 
Inhibition Type:Translation 
Target Start:1574 
Target End:1593 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
Target Start:1039 
Target End:1058 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- AACCUGACUUACCUUGGAGG -5' 
Inhibition Type:Translation 
Target Start:1262 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1523 
Target End:1543 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1637 
Target End:1657 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1250 
Target End:1270 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1256 
Target End:1276 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:515 
Target End:535 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGUC -5' 
Inhibition Type:Translation 
Target Start:209 
Target End:229 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
Target Start:270 
Target End:290 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
Target Start:955 
Target End:975 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGUC -5' 
Inhibition Type:Translation 
Target Start:262 
Target End:282 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:503 
Target End:523 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
Target Start:862 
Target End:882 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGUU -5' 
Inhibition Type:Translation 
Target Start:377 
Target End:396 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
Target Start:422 
Target End:441 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:587 
Target End:606 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:418 
Target End:437 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
Target Start:254 
Target End:273 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUGAAUUUCUUCUAGG -5' 
Inhibition Type:Translation 
Target Start:1040 
Target End:1059 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUGACUUACCUUGGAG -5' 
Inhibition Type:Cleavage 
Target Start:377 
Target End:396 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
Target Start:422 
Target End:441 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:1039 
Target End:1059 
Target Aligned Fragment:3'- GAACCUGACUUACCUUGGAGG -5' 
Inhibition Type:Cleavage 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:587 
Target End:606 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:418 
Target End:437 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
Target Start:116 
Target End:136 
Target Aligned Fragment:3'- GUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
Target Start:11 
Target End:31 
Target Aligned Fragment:3'- GUGUGUGUGUGUGURUGUSUG -5' 
Inhibition Type:Cleavage 
Target Start:2040 
Target End:2060 
Target Aligned Fragment:3'- GUAUGUGUAUGUGUGUGUGUG -5' 
Inhibition Type:Translation 
Target Start:150 
Target End:170 
Target Aligned Fragment:3'- UUGUGUGUGUGUGUAUGCGUG -5' 
Inhibition Type:Cleavage 
Target Start:160 
Target End:180 
Target Aligned Fragment:3'- GUGUGUGUGUUUGUAUUUGUG -5' 
Inhibition Type:Translation 
Target Start:600 
Target End:620 
Target Aligned Fragment:3'- GUAGGUGUUUGUGUGUGUGUG -5' 
Inhibition Type:Translation 
Target Start:103 
Target End:122 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- UUUUGUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
Target Start:347 
Target End:367 
Target Aligned Fragment:3'- GUGUGUGCGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- GUUUGUGUGUGUGUGUGUCU -5' 
Inhibition Type:Cleavage 
Target Start:256 
Target End:275 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- GUGAGUGUGUGGGUAUGUGU -5' 
Inhibition Type:Cleavage 
Target Start:708 
Target End:727 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- GUGUGUGUGGGUGUGUGUAU -5' 
Inhibition Type:Translation 
Target Start:1250 
Target End:1270 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1256 
Target End:1276 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1523 
Target End:1543 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1637 
Target End:1657 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:503 
Target End:523 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
Target Start:314 
Target End:334 
Target Aligned Fragment:3'- UUUUACGACUACUAUGAUGUU -5' 
Inhibition Type:Cleavage 
Target Start:185 
Target End:205 
Target Aligned Fragment:3'- UUUUACGACUACUAUGAUGUU -5' 
Inhibition Type:Cleavage 
Target Start:887 
Target End:907 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
Target Start:29 
Target End:48 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UUUUAGGAGUACUGCGACGA -5' 
Inhibition Type:Translation 
Target Start:46 
Target End:65 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
Target Start:232 
Target End:251 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUAAACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
Target Start:367 
Target End:386 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUAAACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
Target Start:2505 
Target End:2525 
Target Aligned Fragment:3'- CGACGUGGACUUGGACGUGGU -5' 
Inhibition Type:Translation 
Target Start:1080 
Target End:1100 
Target Aligned Fragment:3'- CGACGUGGACUUGGACGUGGU -5' 
Inhibition Type:Translation 
Target Start:727 
Target End:746 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGUCGUGGACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
Target Start:1227 
Target End:1247 
Target Aligned Fragment:3'- GGACGUGGWCGUUGACGUGGY -5' 
Inhibition Type:Cleavage 
Target Start:1086 
Target End:1106 
Target Aligned Fragment:3'- GGACGUGGWCGUUGACGUGGY -5' 
Inhibition Type:Cleavage 
Target Start:678 
Target End:698 
Target Aligned Fragment:3'- GGACGUGAACGUGAACGUGGU -5' 
Inhibition Type:Cleavage 
Target Start:382 
Target End:401 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGAACGUGU -5' 
Inhibition Type:Cleavage 
Target Start:363 
Target End:383 
Target Aligned Fragment:3'- AGACGUAGACGUAGACGUAGU -5' 
Inhibition Type:Cleavage 
Target Start:2 
Target End:22 
Target Aligned Fragment:3'- GGASGUGGAGGUGGAGGUGGU -5' 
Inhibition Type:Translation 
Target Start:1633 
Target End:1652 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GAACGUGGACGUGAACGUGG -5' 
Inhibition Type:Cleavage 
Target Start:40 
Target End:59 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGGAGGUCG -5' 
Inhibition Type:Cleavage 
Target Start:116 
Target End:137 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
Target Start:13 
Target End:34 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGUGURUGUS -5' 
Inhibition Type:Cleavage 
Target Start:2036 
Target End:2057 
Target Aligned Fragment:3'- UGUGUAUGUGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
Target Start:34 
Target End:55 
Target Aligned Fragment:3'- CAUGCAUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
Target Start:346 
Target End:366 
Target Aligned Fragment:3'- UGUGUGCGUGUGUGUGUAUGU -5' 
Inhibition Type:Cleavage 
Target Start:67 
Target End:88 
Target Aligned Fragment:3'- UAUAUAUCUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
Target Start:166 
Target End:186 
Target Aligned Fragment:3'- UAUGUAGGUGUGUGUAUAUGU -5' 
Inhibition Type:Cleavage 
Target Start:99 
Target End:119 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUCUCU -5' 
Inhibition Type:Cleavage 
Target Start:707 
Target End:726 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUAC-3' 
Target Aligned Fragment:3'- UGUGUGUGGGUGUGUGUAUA -5' 
Inhibition Type:Translation 
Target Start:1741 
Target End:1760 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUAC-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGAGAAUG -5' 
Inhibition Type:Cleavage 
Target Start:717 
Target End:739 
Target Aligned Fragment:3'- UGUGUGUGUGUUGUGUGUAUGAG -5' 
Inhibition Type:Translation 
Target Start:2453 
Target End:2473 
Target Aligned Fragment:3'- UAUGUAUGUUUAUCUGUAUGU -5' 
Inhibition Type:Translation 
Target Start:1259 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGUC -5' 
Inhibition Type:Cleavage 
Target Start:1520 
Target End:1543 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGUC -5' 
Inhibition Type:Cleavage 
Target Start:1259 
Target End:1282 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCAUC -5' 
Inhibition Type:Cleavage 
Target Start:1634 
Target End:1657 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGCC -5' 
Inhibition Type:Cleavage 
Target Start:1253 
Target End:1276 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUCAUC -5' 
Inhibition Type:Cleavage 
Target Start:1286 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUUAUC -5' 
Inhibition Type:Cleavage 
Target Start:1250 
Target End:1270 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1309 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:512 
Target End:535 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGUCUUC -5' 
Inhibition Type:Translation 
Target Start:2530 
Target End:2549 
miRNA Aligned Fragment:5'-GGUCAUGCUCUGACAGCCUC-3' 
Target Aligned Fragment:3'- CUGGUGUGAGACUGUCUGAG -5' 
Inhibition Type:Cleavage 
Target Start:549 
Target End:569 
Target Aligned Fragment:3'- CACUUUAGUAGUUGUAAGUGU -5' 
Inhibition Type:Cleavage 
Target Start:879 
Target End:899 
Target Aligned Fragment:3'- CACCGUGGUAGUUCUAAAUUU -5' 
Inhibition Type:Cleavage 
Target Start:1003 
Target End:1022 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCCAAGUU -5' 
Inhibition Type:Cleavage 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
Target Start:1564 
Target End:1583 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
Target Start:1250 
Target End:1269 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1256 
Target End:1275 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1523 
Target End:1542 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:1637 
Target End:1656 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
Target Start:405 
Target End:424 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- AUUAGAACUACUACAGUGUA -5' 
Inhibition Type:Cleavage 
Target Start:1251 
Target End:1272 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1257 
Target End:1278 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1311 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1311 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1311 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1545 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1638 
Target End:1659 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1284 
Target Aligned Fragment:3'- CCCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1284 
Target Aligned Fragment:3'- UCCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:525 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:888 
Target End:909 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:99 
Target End:118 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
Target Start:99 
Target End:118 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
Target Start:450 
Target End:469 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
Target Start:450 
Target End:469 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
Target Start:543 
Target End:562 
miRNA Aligned Fragment:5'-AGACUACAAUUAUCUGAUCA-3' 
Target Aligned Fragment:3'- UCUGGUGUUAGUAUAUUAGU -5' 
Inhibition Type:Cleavage 
Target Start:543 
Target End:562 
miRNA Aligned Fragment:5'-AGACUACAAUUAUCUGAUCA-3' 
Target Aligned Fragment:3'- UCUGGUGUUAGUAUAUUAGU -5' 
Inhibition Type:Cleavage 
Target Start:141 
Target End:160 
miRNA Aligned Fragment:5'-AGACUACAAUUAUCUGAUCA-3' 
Target Aligned Fragment:3'- UCUGGUGUUAAGAGAAUGGU -5' 
Inhibition Type:Cleavage 
Target Start:1764 
Target End:1784 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:554 
Target End:574 
Target Aligned Fragment:3'- GCGGAACGAGGAACAUACGAU -5' 
Inhibition Type:Cleavage 
Target Start:551 
Target End:571 
Target Aligned Fragment:3'- ACGGACCGGUGAACGAACGGU -5' 
Inhibition Type:Translation 
Target Start:203 
Target End:225 
Target Aligned Fragment:3'- ACAAGAGAAGGAGACGUGAGAGA -5' 
Inhibition Type:Cleavage 
Target Start:69 
Target End:91 
Target Aligned Fragment:3'- ACAAGAGAAGGAGACGUGAGAGA -5' 
Inhibition Type:Cleavage 
Target Start:1977 
Target End:1999 
Target Aligned Fragment:3'- AUAGAAGAAGAAGAUGUGAAAAG -5' 
Inhibition Type:Cleavage 
Target Start:894 
Target End:916 
Target Aligned Fragment:3'- ACAGAAGAAGAAGUAGUGAUAAA -5' 
Inhibition Type:Cleavage 
Target Start:362 
Target End:384 
Target Aligned Fragment:3'- ACAAGAGAAGGAGACGUGAAAGG -5' 
Inhibition Type:Cleavage 
Target Start:275 
Target End:297 
Target Aligned Fragment:3'- GUAGAAGAAGAAGAAGUGAUGAA -5' 
Inhibition Type:Cleavage 
Target Start:150 
Target End:172 
Target Aligned Fragment:3'- CCAGAAGAAGAAGAAGUGGUAGA -5' 
Inhibition Type:Cleavage 
Target Start:685 
Target End:706 
Target Aligned Fragment:3'- GUAAGAGAAGGAGGUGUGAUAA -5' 
Inhibition Type:Cleavage 
Target Start:1304 
Target End:1326 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:1301 
Target End:1323 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:1139 
Target End:1161 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:1139 
Target End:1161 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:761 
Target End:783 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:323 
Target End:345 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:17 
Target End:39 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
Target Start:17 
Target End:39 
Target Aligned Fragment:3'- ACAAAAGAAGAAGGAGUGAAAGG -5' 
Inhibition Type:Cleavage 
Target Start:1640 
Target End:1662 
Target Aligned Fragment:3'- ACAAAAGAAGAAGGAGUGAAAGG -5' 
Inhibition Type:Cleavage 
Target Start:26 
Target End:48 
Target Aligned Fragment:3'- ACAAAAGAAGAAGGAGUGAAAGG -5' 
Inhibition Type:Cleavage 
Target Start:960 
Target End:982 
Target Aligned Fragment:3'- ACAGAAGAAGGAGGAGUGAUGGG -5' 
Inhibition Type:Cleavage 
Target Start:408 
Target End:430 
Target Aligned Fragment:3'- GUAAAAGAAGAAGAAGUGAAAGA -5' 
Inhibition Type:Cleavage 
Target Start:1227 
Target End:1247 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1356 
Target End:1376 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1380 
Target End:1400 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1908 
Target End:1928 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
Target Start:1254 
Target End:1274 
Target Aligned Fragment:3'- AGUAACUCACGUCGUAACUAC -5' 
Inhibition Type:Cleavage 
Target Start:697 
Target End:716 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AGUAACUCGCGUCGCAACUA -5' 
Inhibition Type:Cleavage 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- CAUAACUCACGUCGCAACUA -5' 
Inhibition Type:Cleavage 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- CAUAACUCACGUCGCAACUA -5' 
Inhibition Type:Cleavage 
Target Start:66 
Target End:86 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
Target Start:66 
Target End:86 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
Target Start:66 
Target End:86 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
Target Start:66 
Target End:86 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AAUAACUCACGUUGUAACUA -5' 
Inhibition Type:Cleavage 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AAUAACUCACGUUGUAACUA -5' 
Inhibition Type:Cleavage 
Target Start:449 
Target End:469 
Target Aligned Fragment:3'- AGUAGCUCCCGUCGCCACUAC -5' 
Inhibition Type:Translation 
Target Start:845 
Target End:865 
Target Aligned Fragment:3'- ACUGACUCCCGUCGCAACUAC -5' 
Inhibition Type:Translation 
Target Start:675 
Target End:695 
Target Aligned Fragment:3'- AGCAACUCACGACGCAACUAU -5' 
Inhibition Type:Cleavage 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AGUAACUCACAUUGUGACUA -5' 
Inhibition Type:Translation 
Target Start:681 
Target End:701 
Target Aligned Fragment:3'- AGCAACUCACGACGUAACUAU -5' 
Inhibition Type:Cleavage 
Target Start:681 
Target End:701 
Target Aligned Fragment:3'- AGCAACUCACGACGUAACUAU -5' 
Inhibition Type:Cleavage 
Target Start:2013 
Target End:2033 
Target Aligned Fragment:3'- GUGGUUUCUUCUUAAUGUGAU -5' 
Inhibition Type:Cleavage 
Target Start:482 
Target End:501 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCU-3' 
Target Aligned Fragment:3'- AAGGUUUCCUCUUAAUUGGA -5' 
Inhibition Type:Cleavage 
Target Start:3301 
Target End:3321 
Target Aligned Fragment:3'- ACCGUUUUCUCGAAACGGGUU -5' 
Inhibition Type:Cleavage 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
Target Start:140 
Target End:159 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- ACGGUUUCCUCAAAACGCGC -5' 
Inhibition Type:Cleavage 
Target Start:1228 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
Target Start:1357 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
Target Start:1381 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
Target Start:1909 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
Target Start:653 
Target End:673 
Target Aligned Fragment:3'- GUGUGUGUGUGUGUGUAUAUA -5' 
Inhibition Type:Cleavage 
Target Start:2038 
Target End:2058 
Target Aligned Fragment:3'- AUGUGUAUGUGUGUGUGUGUA -5' 
Inhibition Type:Cleavage 
Target Start:15 
Target End:35 
Target Aligned Fragment:3'- AUAUGUGUGUGUGUGUGURUG -5' 
Inhibition Type:Cleavage 
Target Start:167 
Target End:187 
Target Aligned Fragment:3'- AUAUGUAGGUGUGUGUAUAUG -5' 
Inhibition Type:Cleavage 
Target Start:116 
Target End:136 
Target Aligned Fragment:3'- GUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
Target Start:707 
Target End:727 
Target Aligned Fragment:3'- GUGUGUGUGGGUGUGUGUAUA -5' 
Inhibition Type:Translation 
Target Start:66 
Target End:85 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- AUAUCUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
Target Start:347 
Target End:367 
Target Aligned Fragment:3'- GUGUGUGCGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
Target Start:1137 
Target End:1156 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- AUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
Target Start:1146 
Target End:1165 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- AUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
Target Start:91 
Target End:111 
Target Aligned Fragment:3'- GUAUGUAUAUAUGUGUAUGUG -5' 
Inhibition Type:Translation 
Target Start:1741 
Target End:1761 
Target Aligned Fragment:3'- AUAUGUGUGUGUGUGAGAAUG -5' 
Inhibition Type:Cleavage 
Target Start:170 
Target End:189 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- GUGUGUAUGUGUGUGUUAAU -5' 
Inhibition Type:Cleavage 
Target Start:1253 
Target End:1272 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGUAACUACU -5' 
Inhibition Type:Cleavage 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:844 
Target End:863 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGUCGCAACUACU -5' 
Inhibition Type:Cleavage 
Target Start:695 
Target End:714 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCGCGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:2372 
Target End:2391 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:674 
Target End:693 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
Target Start:785 
Target End:804 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCGCGUCGCAACUAGU -5' 
Inhibition Type:Cleavage 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
Target Start:203 
Target End:222 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGGCGCAACUACU -5' 
Inhibition Type:Translation 
Target Start:939 
Target End:958 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCAUGUUCCAGCUACU -5' 
Inhibition Type:Cleavage 
Target Start:1361 
Target End:1380 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAAUUUACGUCGUAACCAUU -5' 
Inhibition Type:Cleavage 
Target Start:518 
Target End:537 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- YAACUUACGUCGUAACUCUU -5' 
Inhibition Type:Cleavage 
Target Start:230 
Target End:249 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAAACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
Target Start:365 
Target End:384 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAAACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
Target Start:44 
Target End:63 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGGACGUGGACGUGGAG -5' 
Inhibition Type:Cleavage 
Target Start:1172 
Target End:1191 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGAACGUGGACGUGGUG -5' 
Inhibition Type:Cleavage 
Target Start:1631 
Target End:1650 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGGACGUGAACGUGGAG -5' 
Inhibition Type:Cleavage 
Target Start:725 
Target End:744 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UCGUGGACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UUGUAAACGUGGGCUUGGAG -5' 
Inhibition Type:Cleavage 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UUGUAAACGUGGGCUUGGAG -5' 
Inhibition Type:Cleavage 
Target Start:5053 
Target End:5072 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAGACGUGGAGGAGGAG -5' 
Inhibition Type:Cleavage 
Target Start:1253 
Target End:1272 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGUAACUACU -5' 
Inhibition Type:Cleavage 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:844 
Target End:863 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGUCGCAACUACU -5' 
Inhibition Type:Cleavage 
Target Start:784 
Target End:804 
Target Aligned Fragment:3'- CAACUCGCGUCGCAACUAGUU -5' 
Inhibition Type:Cleavage 
Target Start:695 
Target End:714 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCGCGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:2372 
Target End:2391 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
Target Start:674 
Target End:693 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
Target Start:203 
Target End:222 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGGCGCAACUACU -5' 
Inhibition Type:Translation 
Target Start:939 
Target End:958 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCAUGUUCCAGCUACU -5' 
Inhibition Type:Cleavage 
Target Start:782 
Target End:802 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:814 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1007 
Target End:1027 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1156 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2734 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1022 
Target End:1042 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1076 
Target End:1096 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1048 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1048 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:724 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:770 
Target End:790 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:865 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1099 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1099 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:956 
Target End:976 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:39 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAG-AUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCGUAUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1373 
Target End:1393 
Target Aligned Fragment:3'- AACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
Target Start:2097 
Target End:2117 
Target Aligned Fragment:3'- AGCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
Target Start:2151 
Target End:2171 
Target Aligned Fragment:3'- AGCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
Target Start:2013 
Target End:2033 
Target Aligned Fragment:3'- AGCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
Target Start:10406 
Target End:10426 
Target Aligned Fragment:3'- AACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
Target Start:109 
Target End:129 
Target Aligned Fragment:3'- AAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:258 
Target End:278 
Target Aligned Fragment:3'- GAACCUAAUUGUCCUCGAGAU -5' 
Inhibition Type:Translation 
Target Start:100 
Target End:120 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:586 
Target End:606 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:1673 
Target End:1693 
Target Aligned Fragment:3'- AAACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
Target Start:1640 
Target End:1660 
Target Aligned Fragment:3'- AAACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:225 
Target End:244 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:991 
Target End:1010 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACUUAAUUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
Target Start:933 
Target End:952 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAAUUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:2648 
Target End:2667 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AGACCUGACUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
Target Start:582 
Target End:602 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:1047 
Target End:1067 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGUUGUUUGGACAUGUAGGU -5' 
Inhibition Type:Cleavage 
Target Start:1537 
Target End:1556 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AACUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
Target Start:1726 
Target End:1745 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AAUUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
Target Start:2719 
Target End:2738 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGCUGUUUGGAUGAGUAGGU -5' 
Inhibition Type:Cleavage 
Target Start:539 
Target End:559 
Target Aligned Fragment:3'- AGCGAACCACGUCCAGCCCUU -5' 
Inhibition Type:Cleavage 
Target Start:356 
Target End:376 
Target Aligned Fragment:3'- GGCGGACCAUGUUCAGUCUUU -5' 
Inhibition Type:Cleavage 
Target Start:651 
Target End:671 
Target Aligned Fragment:3'- AGUGAAUCACGUCAAGCCUUU -5' 
Inhibition Type:Cleavage 
Target Start:4713 
Target End:4733 
Target Aligned Fragment:3'- AGUGAAUCACGUCAAGCCUUU -5' 
Inhibition Type:Cleavage 
Target Start:4992 
Target End:5012 
Target Aligned Fragment:3'- AGUGAAUCACGUCAAGCCUUU -5' 
Inhibition Type:Cleavage 
Target Start:584 
Target End:604 
Target Aligned Fragment:3'- AGCGAACCAUGUUCAGGUUUU -5' 
Inhibition Type:Cleavage 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
Target Start:420 
Target End:439 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
Target Start:955 
Target End:975 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1027 
Target End:1047 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1027 
Target End:1047 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1075 
Target End:1095 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1078 
Target End:1098 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1078 
Target End:1098 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1021 
Target End:1041 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1006 
Target End:1026 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:991 
Target End:1011 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:781 
Target End:801 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
Target Start:769 
Target End:789 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUGU -5' 
Inhibition Type:Translation 
Target Start:1720 
Target End:1739 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCUGUCUUCUUUAUUUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:38 
Target End:59 
miRNA Aligned Fragment:5'-UGACAGAAG-AGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCGUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGUUGUUUGGACAUGUAGGU -5' 
Inhibition Type:Cleavage 
Target Start:1537 
Target End:1556 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AACUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
Target Start:1726 
Target End:1745 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AAUUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
Target Start:2719 
Target End:2738 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGCUGUUUGGAUGAGUAGGU -5' 
Inhibition Type:Cleavage 
Target Start:248 
Target End:267 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGUAACAGACAAGCUGGA -5' 
Inhibition Type:Cleavage 
Target Start:336 
Target End:355 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAAUAGACAAGCUGGG -5' 
Inhibition Type:Cleavage 
Target Start:1046 
Target End:1066 
Target Aligned Fragment:3'- AAAGUAACAGACAGUCUGGAA -5' 
Inhibition Type:Cleavage 
Target Start:117 
Target End:136 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGUAACAGACAAGCUGGC -5' 
Inhibition Type:Cleavage 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
Target Start:297 
Target End:316 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
Target Start:297 
Target End:316 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
Target Start:336 
Target End:355 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
Target Start:201 
Target End:220 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAAGCUGGC -5' 
Inhibition Type:Cleavage 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
Target Start:234 
Target End:253 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
Target Start:300 
Target End:319 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCAGGA -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAACAGUCAAGCUGGA -5' 
Inhibition Type:Translation 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCGGGA -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCGGGA -5' 
Inhibition Type:Cleavage 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAGGCUGGC -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAGGCUGGC -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAGGCUGGC -5' 
Inhibition Type:Cleavage 
Target Start:225 
Target End:244 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGCAACAGACAGGMCGGA -5' 
Inhibition Type:Cleavage 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCGGGG -5' 
Inhibition Type:Cleavage 
Target Start:310 
Target End:331 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:2341 
Target End:2362 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AGAACGAGUUUACUGACAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AAAACGAGUUUACUCGCAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:367 
Target End:388 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:307 
Target End:328 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUCAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:325 
Target End:346 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:367 
Target End:388 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:343 
Target End:364 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:340 
Target End:361 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:148 
Target End:169 
Target Aligned Fragment:3'- AGGACGACUCUACUCAUAAGGU -5' 
Inhibition Type:Translation 
Target Start:973 
Target End:994 
Target Aligned Fragment:3'- AGGACGAGUUCACUCUUAAGGU -5' 
Inhibition Type:Translation 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:39 
Target End:59 
miRNA Aligned Fragment:5'-UGACAGAAG-AUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCGUAUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:1625 
Target End:1644 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCGGUCUUUUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1472 
Target End:1491 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCGGUCUUUUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Translation 
Target Start:10406 
Target End:10425 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
Target Start:2013 
Target End:2032 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
Target Start:312 
Target End:332 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:348 
Target End:368 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:546 
Target End:566 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:351 
Target End:371 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:600 
Target End:620 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:654 
Target End:674 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:558 
Target End:578 
Target Aligned Fragment:3'- AGGYGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:774 
Target End:794 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
Target Start:753 
Target End:773 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
Target Start:372 
Target End:392 
Target Aligned Fragment:3'- AGGUGUUCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
Target Start:630 
Target End:650 
Target Aligned Fragment:3'- AGGUGUACGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:487 
Target End:506 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- AGGUGUACGAAAGAACUUGC -5' 
Inhibition Type:Cleavage 
Target Start:959 
Target End:978 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- AGGUGUUCGAAGGAGUUUGC -5' 
Inhibition Type:Cleavage 
Target Start:1204 
Target End:1223 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- GGGUGUUUGAAAGAACUUGG -5' 
Inhibition Type:Cleavage 
Target Start:121 
Target End:141 
Target Aligned Fragment:3'- AGGUGUCCGGAACAACUUACC -5' 
Inhibition Type:Cleavage 
Target Start:60 
Target End:81 
Target Aligned Fragment:3'- ACCUCCGUUGCCAAGUAACUCG -5' 
Inhibition Type:Cleavage 
Target Start:851 
Target End:870 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGA-3' 
Target Aligned Fragment:3'- AUCUCUGUCGUCAAGUAGUU -5' 
Inhibition Type:Cleavage 
Target Start:560 
Target End:579 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGA-3' 
Target Aligned Fragment:3'- ACUUCCGUCGCCGAGUAGAA -5' 
Inhibition Type:Cleavage 
Target Start:925 
Target End:945 
Target Aligned Fragment:3'- ACCUCCGACGACAAGUAGUUG -5' 
Inhibition Type:Translation 
Target Start:1030 
Target End:1050 
Target Aligned Fragment:3'- ACCUCCGACGACAAGUAGUUG -5' 
Inhibition Type:Translation 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:2698 
Target End:2719 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGGUG -5' 
Inhibition Type:Translation 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
Target Start:151 
Target End:170 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACAGUA -5' 
Inhibition Type:Cleavage 
Target Start:1789 
Target End:1808 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACAGUA -5' 
Inhibition Type:Cleavage 
Target Start:460 
Target End:480 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
Target Start:970 
Target End:990 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
Target Start:916 
Target End:936 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
Target Start:347 
Target End:366 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGGUAUACGAGGACAGUA -5' 
Inhibition Type:Cleavage 
Target Start:1792 
Target End:1811 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACGGUA -5' 
Inhibition Type:Cleavage 
Target Start:2802 
Target End:2821 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAAGACGGUU -5' 
Inhibition Type:Cleavage 
Target Start:3088 
Target End:3107 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAAGACGGUU -5' 
Inhibition Type:Cleavage 
Target Start:408 
Target End:427 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAUACGAAGACUUUA -5' 
Inhibition Type:Cleavage 
Target Start:17 
Target End:36 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- UGAGAGAUAGGGAGACAGUG -5' 
Inhibition Type:Translation 
Target Start:414 
Target End:433 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAUACGAAGACUUUA -5' 
Inhibition Type:Cleavage 
Target Start:1360 
Target End:1379 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGGGAGAGGUGAAGACAGUG -5' 
Inhibition Type:Cleavage 
Target Start:124 
Target End:144 
Target Aligned Fragment:3'- CGAGAGAGACGAUGAGAGUAG -5' 
Inhibition Type:Cleavage 
Target Start:60 
Target End:80 
Target Aligned Fragment:3'- CCUCCGUUGCCAAGUAACUCG -5' 
Inhibition Type:Cleavage 
Target Start:850 
Target End:869 
miRNA Aligned Fragment:5'-GGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- UCUCUGUCGUCAAGUAGUUU -5' 
Inhibition Type:Cleavage 
Target Start:4137 
Target End:4156 
miRNA Aligned Fragment:5'-CCCGCCUUGCAUCAACUGAA-3' 
Target Aligned Fragment:3'- GGGCGAAACGUGGUUGACUU -5' 
Inhibition Type:Cleavage 
Target Start:267 
Target End:286 
miRNA Aligned Fragment:5'-CCCGCCUUGCAUCAACUGAA-3' 
Target Aligned Fragment:3'- GGACGGAACGUAGUUAACUU -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Translation 
Target Start:1720 
Target End:1739 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCUGUCUUCUUUAUUUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:2316 
Target End:2335 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUUUCUUUUUUCUG -5' 
Inhibition Type:Cleavage 
Target Start:780 
Target End:799 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
Target Start:954 
Target End:973 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1026 
Target End:1045 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1026 
Target End:1045 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1074 
Target End:1093 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1020 
Target End:1039 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1005 
Target End:1024 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:768 
Target End:787 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUAUCUCCCGUGUU -5' 
Inhibition Type:Cleavage 
Target Start:1577 
Target End:1596 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- CGUCUUCUYUCUUUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:1623 
Target End:1642 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- GGUCUUUUAUCUCUCGUGGC -5' 
Inhibition Type:Cleavage 
Target Start:1470 
Target End:1489 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- GGUCUUUUAUCUCUCGUGGC -5' 
Inhibition Type:Cleavage 
Target Start:990 
Target End:1009 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCGCUCGUGUC -5' 
Inhibition Type:Translation 
Target Start:792 
Target End:811 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCC -5' 
Inhibition Type:Translation 
Target Start:262 
Target End:281 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUGUUUUUGGUGUC -5' 
Inhibition Type:Cleavage 
Target Start:262 
Target End:281 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUGUUUUUGGUGUC -5' 
Inhibition Type:Cleavage 
Target Start:2712 
Target End:2731 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCU -5' 
Inhibition Type:Translation 
Target Start:1134 
Target End:1153 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCU -5' 
Inhibition Type:Translation 
Target Start:843 
Target End:862 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCA -5' 
Inhibition Type:Translation 
Target Start:37 
Target End:57 
miRNA Aligned Fragment:5'-ACAGAAG-AUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCGUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUUUAACUCUCGUUUC -5' 
Inhibition Type:Translation 
Target Start:44 
Target End:63 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- ACCUUGACUUCCUUUGAGGA -5' 
Inhibition Type:Cleavage 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
Target Start:298 
Target End:317 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:1180 
Target End:1199 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:2649 
Target End:2668 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AGCCUGGCUUACCUUGGGGA -5' 
Inhibition Type:Translation 
Target Start:313 
Target End:332 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUA -5' 
Inhibition Type:Translation 
Target Start:1226 
Target End:1245 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGGUUUCCCACAAGGA -5' 
Inhibition Type:Cleavage 
Target Start:1540 
Target End:1559 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCCAGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1517 
Target End:1537 
Target Aligned Fragment:3'- GAACCCCACUUCCUUCGAGGC -5' 
Inhibition Type:Cleavage 
Target Start:1589 
Target End:1609 
Target Aligned Fragment:3'- GAACCCCACUUCCUUCGAGGC -5' 
Inhibition Type:Cleavage 
Target Start:2211 
Target End:2231 
Target Aligned Fragment:3'- AAACCUCACUUACUUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:1104 
Target End:1123 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- UAGCCUCGUUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
Target Start:398 
Target End:418 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:404 
Target End:424 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:623 
Target End:643 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
Target Start:1175 
Target End:1194 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACACAACAAAGAACAAAA -5' 
Inhibition Type:Cleavage 
Target Start:59 
Target End:78 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCAAAAAGUAAAA -5' 
Inhibition Type:Cleavage 
Target Start:1733 
Target End:1752 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACGCAACAAAAAACAAAC -5' 
Inhibition Type:Cleavage 
Target Start:1913 
Target End:1932 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACGCAACAAAAAAGAAAA -5' 
Inhibition Type:Cleavage 
Target Start:2555 
Target End:2574 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACGCAACAAAAAAGAAAA -5' 
Inhibition Type:Cleavage 
Target Start:738 
Target End:757 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACGACAAGAAGCAAAC -5' 
Inhibition Type:Cleavage 
Target Start:98 
Target End:117 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACAAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
Target Start:536 
Target End:555 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACAUAACGAAAAAUAAAG -5' 
Inhibition Type:Cleavage 
Target Start:327 
Target End:346 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AGACAAAACAAAAAACGAAA -5' 
Inhibition Type:Cleavage 
Target Start:514 
Target End:533 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
Target Start:869 
Target End:888 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACACAACGAAGAAUGAAA -5' 
Inhibition Type:Cleavage 
Target Start:1033 
Target End:1052 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
Target Start:599 
Target End:618 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAGAAUCAAA -5' 
Inhibition Type:Cleavage 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
Target Start:1324 
Target End:1343 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
Target Start:908 
Target End:927 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCGAAAGGUAAAA -5' 
Inhibition Type:Cleavage 
Target Start:866 
Target End:885 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCGAAAGGUAAAA -5' 
Inhibition Type:Cleavage 
Target Start:2389 
Target End:2408 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACAUAAGAAAAAGCAAAA -5' 
Inhibition Type:Translation 
Target Start:16 
Target End:35 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAAUACGACGGGAAACAAAA -5' 
Inhibition Type:Cleavage 
Target Start:394 
Target End:413 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAAGGCUAAA -5' 
Inhibition Type:Cleavage 
Target Start:181 
Target End:200 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACGAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
Target Start:471 
Target End:490 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACACUACAAAAAACAAAG -5' 
Inhibition Type:Cleavage 
Target Start:68 
Target End:87 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AACCAAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
Target Start:39 
Target End:58 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACAAAAUAAAAGACAGAA -5' 
Inhibition Type:Cleavage 
Target Start:189 
Target End:208 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAGCACGGCGAAGAACGAAA -5' 
Inhibition Type:Cleavage 
Target Start:1833 
Target End:1853 
Target Aligned Fragment:3'- UUUUACAACGGACCGAACUCC -5' 
Inhibition Type:Cleavage 
Target Start:51 
Target End:71 
Target Aligned Fragment:3'- UCUUACAGCAGGCUGGGCUUU -5' 
Inhibition Type:Cleavage 
Target Start:51 
Target End:71 
Target Aligned Fragment:3'- UCUUACAGCAGGCUGGGCUUU -5' 
Inhibition Type:Cleavage 
Target Start:1752 
Target End:1772 
Target Aligned Fragment:3'- UUUUACAACGGGCCGAACUCC -5' 
Inhibition Type:Cleavage 
Target Start:1752 
Target End:1772 
Target Aligned Fragment:3'- UUUUACAACGGGCCGAACUCC -5' 
Inhibition Type:Cleavage 
Target Start:895 
Target End:914 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- UUUUAUGGCAGACCGAGUUC -5' 
Inhibition Type:Cleavage 
Target Start:1012 
Target End:1031 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- UUUUAUGGCAGACCGAGUUC -5' 
Inhibition Type:Cleavage 
Target Start:1743 
Target End:1763 
Target Aligned Fragment:3'- UCUUACAAAGGACCGAACUCC -5' 
Inhibition Type:Translation 
Target Start:423 
Target End:442 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- CUUUACAACCGGUUGAGCUC -5' 
Inhibition Type:Translation 
Target Start:423 
Target End:442 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- CUUUACAACCGGUUGAGCUC -5' 
Inhibition Type:Translation 
Target Start:954 
Target End:973 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AGUCUUGAGACAGGUGGAGG -5' 
Inhibition Type:Cleavage 
Target Start:1198 
Target End:1217 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- CAUCGUGAGACAGGUGGAAG -5' 
Inhibition Type:Cleavage 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AAUCUUAAGACAGGAGGAGG -5' 
Inhibition Type:Cleavage 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AAUCUUAAGACAGGAGGAGG -5' 
Inhibition Type:Cleavage 
Target Start:438 
Target End:457 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- GGCCGUAAGGCGGGUGGAAG -5' 
Inhibition Type:Cleavage 
Target Start:3 
Target End:22 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AACCGUAACGCAGGAGGAGG -5' 
Inhibition Type:Translation 
Target Start:27 
Target End:47 
miRNA Aligned Fragment:5'-UUGGCAUUC-UGUCCACCUCC-3' 
Target Aligned Fragment:3'- AACCGUAAGAACAGGUGGACG -5' 
Inhibition Type:Translation 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
Target Start:1288 
Target End:1308 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
Target Start:1285 
Target End:1305 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
Target Start:2743 
Target End:2763 
Target Aligned Fragment:3'- GAGGUGCGGAAAGGAGUUGAC -5' 
Inhibition Type:Cleavage 
Target Start:312 
Target End:333 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:348 
Target End:369 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:546 
Target End:567 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:351 
Target End:372 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:600 
Target End:621 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:2234 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGA -5' 
Inhibition Type:Cleavage 
Target Start:776 
Target End:795 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
Target Start:755 
Target End:774 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
Target Start:572 
Target End:591 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AAGGUGCUYGAAGAACUCGA -5' 
Inhibition Type:Translation 
Target Start:3086 
Target End:3105 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GGGGUGCCGAAAGAGUUCGA -5' 
Inhibition Type:Cleavage 
Target Start:3086 
Target End:3105 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GGGGUGCCGAAAGAGUUCGA -5' 
Inhibition Type:Cleavage 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCG-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCG-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:666 
Target End:686 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCG-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
Target Start:437 
Target End:457 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:914 
Target End:934 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:962 
Target End:982 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:666 
Target End:686 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
Target Start:849 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
Target Start:1620 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1227 
Target End:1247 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1356 
Target End:1376 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1380 
Target End:1400 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1908 
Target End:1928 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUGGUUCGGCACGGUUUUA -5' 
Inhibition Type:Cleavage 
Target Start:447 
Target End:466 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUGGUUCGGCACGGUUUUA -5' 
Inhibition Type:Cleavage 
Target Start:948 
Target End:967 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAAUUUGGCACGGUUUUG -5' 
Inhibition Type:Cleavage 
Target Start:661 
Target End:680 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCCAUACGGUUGUA -5' 
Inhibition Type:Translation 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUUCGUACGUUUAUA -5' 
Inhibition Type:Translation 
Target Start:2314 
Target End:2333 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUUCGUACGCUUAUA -5' 
Inhibition Type:Translation 
Target Start:2184 
Target End:2203 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUUCGUACGUUUAUA -5' 
Inhibition Type:Translation 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1764 
Target End:1784 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
Target Start:59 
Target End:79 
Target Aligned Fragment:3'- CCGGAUCGAGGGAUGAACGGU -5' 
Inhibition Type:Cleavage 
Target Start:154 
Target End:173 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGGCCGAAGGAGGUACGG -5' 
Inhibition Type:Translation 
Target Start:527 
Target End:547 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
Target Start:617 
Target End:637 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
Target Start:797 
Target End:817 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACGA -5' 
Inhibition Type:Cleavage 
Target Start:94 
Target End:114 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:644 
Target End:664 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
Target Start:644 
Target End:664 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUCUACU -5' 
Inhibition Type:Cleavage 
Target Start:76 
Target End:96 
Target Aligned Fragment:3'- ACUUCUUCGUCUCCUGUGUGG -5' 
Inhibition Type:Cleavage 
Target Start:7 
Target End:27 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGA -5' 
Inhibition Type:Cleavage 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
Target Start:264 
Target End:283 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
Target Start:16 
Target End:36 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGG -5' 
Inhibition Type:Cleavage 
Target Start:379 
Target End:399 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGG -5' 
Inhibition Type:Cleavage 
Target Start:25 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUUCACG -5' 
Inhibition Type:Cleavage 
Target Start:1227 
Target End:1247 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1356 
Target End:1376 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1380 
Target End:1400 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1908 
Target End:1928 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAU-3' 
Target Aligned Fragment:3'- ACCAAUUCGGUGCAGUUGUA -5' 
Inhibition Type:Cleavage 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
Target Start:2039 
Target End:2059 
Target Aligned Fragment:3'- UAUGUGUAUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
Target Start:14 
Target End:34 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGUGURUGU -5' 
Inhibition Type:Cleavage 
Target Start:115 
Target End:135 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
Target Start:66 
Target End:86 
Target Aligned Fragment:3'- UAUAUCUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1137 
Target End:1157 
Target Aligned Fragment:3'- UAUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
Target Start:1146 
Target End:1166 
Target Aligned Fragment:3'- UAUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
Target Start:937 
Target End:956 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- AGUAUGUAUGUGUGUAUGUU -5' 
Inhibition Type:Cleavage 
Target Start:90 
Target End:110 
Target Aligned Fragment:3'- UAUGUAUAUAUGUGUAUGUGU -5' 
Inhibition Type:Translation 
Target Start:89 
Target End:110 
miRNA Aligned Fragment:5'-AUAUACAUAC-ACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUUGUGUAUGUGU -5' 
Inhibition Type:Translation 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUGUAUGUGGGUGUGUA -5' 
Inhibition Type:Cleavage 
Target Start:707 
Target End:727 
Target Aligned Fragment:3'- UAUGUGUAUGUGUUUGGGUGU -5' 
Inhibition Type:Cleavage 
Target Start:391 
Target End:410 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUGUAUGUGUGUCUCUC -5' 
Inhibition Type:Cleavage 
Target Start:437 
Target End:457 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:914 
Target End:934 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:962 
Target End:982 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:847 
Target End:868 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGAAG -5' 
Inhibition Type:Translation 
Target Start:1618 
Target End:1639 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGAAG -5' 
Inhibition Type:Translation 
Target Start:666 
Target End:686 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
Target Start:1243 
Target End:1263 
Target Aligned Fragment:3'- GGCUCGGAGGAGUUAUAGAGG -5' 
Inhibition Type:Translation 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
Target Start:292 
Target End:311 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AAUUCGGUUCAGGUAUAGAG -5' 
Inhibition Type:Translation 
Target Start:1578 
Target End:1597 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUUGGUUCAUUUAUAGAG -5' 
Inhibition Type:Translation 
Target Start:666 
Target End:685 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
Target Start:874 
Target End:893 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCCUACUUAACGGUA -5' 
Inhibition Type:Cleavage 
Target Start:1358 
Target End:1377 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUUAACGGCG -5' 
Inhibition Type:Cleavage 
Target Start:1631 
Target End:1650 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUUAACGGCG -5' 
Inhibition Type:Cleavage 
Target Start:437 
Target End:456 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:688 
Target End:707 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UUGGUUUCUACUGAAGGGUU -5' 
Inhibition Type:Cleavage 
Target Start:368 
Target End:387 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UUGGUUUCUACUGAAGGGUU -5' 
Inhibition Type:Cleavage 
Target Start:914 
Target End:933 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:962 
Target End:981 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
Target Start:2635 
Target End:2654 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACCGUCUUCUCUCUCUCCUA -5' 
Inhibition Type:Cleavage 
Target Start:364 
Target End:383 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- AUCGUCUUCUGUCUCUCGUA -5' 
Inhibition Type:Translation 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Translation 
Target Start:777 
Target End:797 
Target Aligned Fragment:3'- UCUUCUAUCUCUCGUGUUGGG -5' 
Inhibition Type:Cleavage 
Target Start:1075 
Target End:1094 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGG -5' 
Inhibition Type:Cleavage 
Target Start:1075 
Target End:1094 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGG -5' 
Inhibition Type:Cleavage 
Target Start:951 
Target End:971 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCAGG -5' 
Inhibition Type:Cleavage 
Target Start:1071 
Target End:1091 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:1017 
Target End:1037 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:1024 
Target End:1043 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGA -5' 
Inhibition Type:Cleavage 
Target Start:1024 
Target End:1043 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGA -5' 
Inhibition Type:Cleavage 
Target Start:1003 
Target End:1022 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGA -5' 
Inhibition Type:Cleavage 
Target Start:36 
Target End:55 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUCUUGU -5' 
Inhibition Type:Cleavage 
Target Start:36 
Target End:55 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUCUUGU -5' 
Inhibition Type:Cleavage 
Target Start:1272 
Target End:1291 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUAGUCUCUCUCGUGUUGG -5' 
Inhibition Type:Cleavage 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCGCUCGUGUCGG -5' 
Inhibition Type:Translation 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCAGG -5' 
Inhibition Type:Cleavage 
Target Start:2710 
Target End:2729 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCUAC -5' 
Inhibition Type:Cleavage 
Target Start:1574 
Target End:1594 
Target Aligned Fragment:3'- UCUUCUYUCUUUCGUGUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCUAC -5' 
Inhibition Type:Cleavage 
Target Start:700 
Target End:719 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCUAA -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUUUUUCUGGUGUUGU -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUUUUUCUGGUGUUGU -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2734 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1156 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1007 
Target End:1027 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:814 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1048 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1028 
Target End:1048 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1076 
Target End:1096 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1022 
Target End:1042 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:956 
Target End:976 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1099 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1079 
Target End:1099 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:865 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:724 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:992 
Target End:1012 
Target Aligned Fragment:3'- UACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:782 
Target End:802 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:41 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGU -5' 
Inhibition Type:Cleavage 
Target Start:41 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGU -5' 
Inhibition Type:Cleavage 
Target Start:770 
Target End:790 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
Target Start:231 
Target End:251 
Target Aligned Fragment:3'- AACUGUCUACUCUUUUUGGUG -5' 
Inhibition Type:Translation 
Target Start:564 
Target End:584 
Target Aligned Fragment:3'- AACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:1006 
Target End:1027 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1027 
Target End:1048 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1027 
Target End:1048 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1075 
Target End:1096 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1021 
Target End:1042 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:2714 
Target End:2734 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:955 
Target End:976 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1136 
Target End:1156 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:1078 
Target End:1099 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:1078 
Target End:1099 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:794 
Target End:814 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:845 
Target End:865 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:704 
Target End:724 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
Target Start:991 
Target End:1012 
Target Aligned Fragment:3'- UACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:781 
Target End:802 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:769 
Target End:790 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUGU -5' 
Inhibition Type:Cleavage 
Target Start:39 
Target End:60 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGUCU -5' 
Inhibition Type:Cleavage 
Target Start:39 
Target End:60 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGUCU -5' 
Inhibition Type:Cleavage 
Target Start:527 
Target End:547 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
Target Start:617 
Target End:637 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
Target Start:797 
Target End:817 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACGA -5' 
Inhibition Type:Cleavage 
Target Start:359 
Target End:379 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:644 
Target End:664 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
Target Start:644 
Target End:664 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
Target Start:2740 
Target End:2759 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACCUCUUGGUCCCGUAAACG -5' 
Inhibition Type:Cleavage 
Target Start:24 
Target End:44 
Target Aligned Fragment:3'- ACCUCUUUGUCCCGAGRCCGA -5' 
Inhibition Type:Cleavage 
Target Start:703 
Target End:723 
Target Aligned Fragment:3'- ACCUUUUCCUUACGUGAACGA -5' 
Inhibition Type:Translation 
Target Start:880 
Target End:900 
Target Aligned Fragment:3'- ACCUUUUCCUUACGUGAACGA -5' 
Inhibition Type:Translation 
Target Start:1226 
Target End:1246 
Target Aligned Fragment:3'- GCCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:1325 
Target End:1345 
Target Aligned Fragment:3'- GCCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
Target Start:469 
Target End:488 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUCGAUG -5' 
Inhibition Type:Cleavage 
Target Start:469 
Target End:488 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUCGAUG -5' 
Inhibition Type:Cleavage 
Target Start:94 
Target End:114 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACGG -5' 
Inhibition Type:Cleavage 
Target Start:405 
Target End:424 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGAGUCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
Target Start:1318 
Target End:1338 
Target Aligned Fragment:3'- AGGGCCUGGUUUGAACUAAGG -5' 
Inhibition Type:Cleavage 
Target Start:380 
Target End:400 
Target Aligned Fragment:3'- AGAGCUUGGACAGAAGUAAGG -5' 
Inhibition Type:Translation 
Target Start:237 
Target End:256 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- UGAACCUGGUUCGAAGUAAG -5' 
Inhibition Type:Cleavage 
Target Start:237 
Target End:256 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- UGAACCUGGUUCGAAGUAAG -5' 
Inhibition Type:Cleavage 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGUGCCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGUGCCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
Target Start:3351 
Target End:3370 
miRNA Aligned Fragment:5'-CGCUAUCCAUCCUGAGUUUC-3' 
Target Aligned Fragment:3'- GCGAUAGGAAGGGCUAAAAG -5' 
Inhibition Type:Translation 
Target Start:3351 
Target End:3370 
miRNA Aligned Fragment:5'-CGCUAUCCAUCCUGAGUUUC-3' 
Target Aligned Fragment:3'- GCGAUAGGAAGGGCUAAAAG -5' 
Inhibition Type:Translation 
Target Start:411 
Target End:431 
Target Aligned Fragment:3'- GCGACGACUCUUUUGCACCCU -5' 
Inhibition Type:Cleavage 
Target Start:243 
Target End:263 
Target Aligned Fragment:3'- CCUACCACUCUUUUACAUCCU -5' 
Inhibition Type:Cleavage 
Target Start:243 
Target End:263 
Target Aligned Fragment:3'- CCUACCACUCUUUUACAUCCU -5' 
Inhibition Type:Cleavage 
Target Start:46 
Target End:66 
Target Aligned Fragment:3'- UCGACGUCUUUUUUACGUCCU -5' 
Inhibition Type:Cleavage 
Target Start:46 
Target End:66 
Target Aligned Fragment:3'- UCGACGUCUUUUUUACGUCCU -5' 
Inhibition Type:Cleavage 
Target Start:51 
Target End:71 
Target Aligned Fragment:3'- CUGACGACUCGUUUACGUCGU -5' 
Inhibition Type:Translation 
Target Start:751 
Target End:771 
Target Aligned Fragment:3'- CCGACGACUUUUUUUUAUACU -5' 
Inhibition Type:Cleavage 
Target Start:1917 
Target End:1937 
Target Aligned Fragment:3'- UCGACGACUGUAUUACGUCCU -5' 
Inhibition Type:Translation 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGG-3' 
Target Aligned Fragment:3'- CUGACGAUUCUUUUACCUUU -5' 
Inhibition Type:Cleavage 
Target Start:1226 
Target End:1247 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
Target Start:1355 
Target End:1376 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
Target Start:1379 
Target End:1400 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
Target Start:1907 
Target End:1928 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
Target Start:890 
Target End:911 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUACA -5' 
Inhibition Type:Translation 
Target Start:198 
Target End:218 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
Target Start:198 
Target End:218 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
Target Start:219 
Target End:239 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
Target Start:228 
Target End:248 
Target Aligned Fragment:3'- AUCAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
Target Start:105 
Target End:124 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUGAGGUGUAGGACUCCAAA -5' 
Inhibition Type:Cleavage 
Target Start:814 
Target End:833 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- UUUAGACGUUGGACUCGAAA -5' 
Inhibition Type:Translation 
Target Start:222 
Target End:241 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- AUUAGACGUGGGAUUAGAAA -5' 
Inhibition Type:Cleavage 
Target Start:202 
Target End:221 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
Target Start:670 
Target End:689 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
Target Start:733 
Target End:752 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
Target Start:334 
Target End:354 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:1657 
Target End:1677 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:609 
Target End:629 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:609 
Target End:629 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAG -5' 
Inhibition Type:Cleavage 
Target Start:315 
Target End:334 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- AACUUCACAAAUCCUCUUGC -5' 
Inhibition Type:Cleavage 
Target Start:1048 
Target End:1067 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- UACUUCACGAACCUUUUUGA -5' 
Inhibition Type:Cleavage 
Target Start:801 
Target End:820 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- GACUUCWCAAACCUCCAUGU -5' 
Inhibition Type:Cleavage 
Target Start:210 
Target End:230 
Target Aligned Fragment:3'- AAUCAAAGUGGGUGUUUGAGC -5' 
Inhibition Type:Translation 
Target Start:1980 
Target End:1999 
Target Aligned Fragment:3'- AAUCUAGGUGU-UGUUUGAGU -5' 
Inhibition Type:Cleavage 
Target Start:43 
Target End:63 
Target Aligned Fragment:3'- ACCUUGACUUCCUUUGAGGAG -5' 
Inhibition Type:Cleavage 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
Target Start:312 
Target End:332 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUAA -5' 
Inhibition Type:Translation 
Target Start:312 
Target End:332 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUAA -5' 
Inhibition Type:Translation 
Target Start:298 
Target End:317 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
Target Start:1180 
Target End:1199 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
Target Start:2649 
Target End:2668 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AGCCUGGCUUACCUUGGGGA -5' 
Inhibition Type:Translation 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
Target Start:516 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGU -5' 
Inhibition Type:Translation 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
Target Start:263 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
Target Start:1091 
Target End:1111 
Target Aligned Fragment:3'- ACUUUGAUUGUCGUACUCGAA -5' 
Inhibition Type:Translation 
Target Start:205 
Target End:226 
miRNA Aligned Fragment:5'-UGAAGCUGCCA-GCAUGAUCUU-3' 
Target Aligned Fragment:3'- ACUUCGACUGUCCGUACUAGGA -5' 
Inhibition Type:Translation 
Target Start:384 
Target End:403 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAACAAAAACAAAA -5' 
Inhibition Type:Translation 
Target Start:56 
Target End:75 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAACUAAAACAGGA -5' 
Inhibition Type:Cleavage 
Target Start:471 
Target End:490 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- ACCAACAAACCGAGACAAAG -5' 
Inhibition Type:Cleavage 
Target Start:670 
Target End:689 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACGAACCAAAACUAAA -5' 
Inhibition Type:Cleavage 
Target Start:703 
Target End:722 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACGAACCAAAACUAAA -5' 
Inhibition Type:Cleavage 
Target Start:1360 
Target End:1379 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAAACCAAAGCAGUG -5' 
Inhibition Type:Cleavage 
Target Start:209 
Target End:228 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAAUCGAAGCAAAC -5' 
Inhibition Type:Cleavage 
Target Start:5654 
Target End:5673 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- CUCAACGAACCAAAAUGAAA -5' 
Inhibition Type:Cleavage 
Target Start:337 
Target End:356 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAAUAUAUCAAAACGAAA -5' 
Inhibition Type:Cleavage 
Target Start:977 
Target End:996 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACCAGCCAGAACAAAA -5' 
Inhibition Type:Cleavage 
Target Start:952 
Target End:971 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAAAUCAAAGUAUAA -5' 
Inhibition Type:Cleavage 
Target Start:1493 
Target End:1512 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUUGACGAACUAAAACAAAG -5' 
Inhibition Type:Cleavage 
Target Start:2120 
Target End:2139 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAACUCGAAACAAAG -5' 
Inhibition Type:Translation 
Target Start:608 
Target End:629 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:608 
Target End:629 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAGG -5' 
Inhibition Type:Cleavage 
Target Start:334 
Target End:354 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:1657 
Target End:1677 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:315 
Target End:334 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- AACUUCACAAAUCCUCUUGC -5' 
Inhibition Type:Cleavage 
Target Start:1048 
Target End:1067 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- UACUUCACGAACCUUUUUGA -5' 
Inhibition Type:Cleavage 
Target Start:363 
Target End:382 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCACAUGACACCUAUA -5' 
Inhibition Type:Translation 
Target Start:1413 
Target End:1432 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCACAUGACACCUAUA -5' 
Inhibition Type:Translation 
Target Start:1278 
Target End:1297 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCAAACUAUACCUGUA -5' 
Inhibition Type:Cleavage 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- GACUUUACGCUAGACCUAUA -5' 
Inhibition Type:Cleavage 
Target Start:1218 
Target End:1237 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- AACUUUACGCUAGACCUAUA -5' 
Inhibition Type:Cleavage 
Target Start:3472 
Target End:3491 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCAGACUAGGUCUAUA -5' 
Inhibition Type:Cleavage 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:1657 
Target End:1676 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:532 
Target End:551 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUAUAAACUUUCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:314 
Target End:333 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCACAAAUCCUCUUGCC -5' 
Inhibition Type:Cleavage 
Target Start:1047 
Target End:1066 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCACGAACCUUUUUGAU -5' 
Inhibition Type:Cleavage 
Target Start:326 
Target End:345 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GCUUCACAACCCCCUUUGGG -5' 
Inhibition Type:Translation 
Target Start:339 
Target End:358 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:535 
Target End:554 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUAUAGACUUUCUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:266 
Target End:285 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- AUUUUACGAACUUCUUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:1277 
Target End:1296 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GCUUCACAACCCCCUUUGGG -5' 
Inhibition Type:Translation 
Target Start:924 
Target End:943 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:831 
Target End:850 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCGUAAACUCGUUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:116 
Target End:135 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCGCGCAUCUCCUUGAG -5' 
Inhibition Type:Translation 
Target Start:31 
Target End:50 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAACUCGUUUGAG -5' 
Inhibition Type:Cleavage 
Target Start:791 
Target End:810 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GAGAGGGAGUUUCCGAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:2054 
Target End:2073 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- AGGAGGGAGUUUCCGAAGGU -5' 
Inhibition Type:Cleavage 
Target Start:497 
Target End:516 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- AAGAGGGAGGUUCCGAAGGU -5' 
Inhibition Type:Translation 
Target Start:690 
Target End:709 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GGGAGGGUGUUUCUGAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:690 
Target End:709 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GGGAGGGUGUUUCUGAGGGU -5' 
Inhibition Type:Cleavage 
Target Start:2233 
Target End:2253 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGAA -5' 
Inhibition Type:Cleavage 
Target Start:361 
Target End:381 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGAG -5' 
Inhibition Type:Cleavage 
Target Start:361 
Target End:381 
miRNA Aligned Fragment:5'-