AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

 

Mature Sequence:5'-CCTGCATCTGCACCTGCACCA-3'

Precursor Sequence:

_

Genome Location:Chr3:26130554..26130534
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000750392 
Target Start:1764 
Target End:1784 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
MDP0000750392 
Target:MDP0000120635 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000131481 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000131481 
Target:MDP0000221322 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000221322 
Target:MDP0000273491 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000273491 
Target:MDP0000232116 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000232116 
Target:MDP0000256621 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000256621 
Target:MDP0000776180 
Target Start:154 
Target End:173 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGGCCGAAGGAGGUACGG -5' 
Inhibition Type:Translation 
MDP0000776180 
Target:MDP0000251484 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000005879 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000005879 
Target:MDP0000242861 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2700 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Translation 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000209716 
Target Start:564 
Target End:583 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000209716 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000276433 
Target Start:1509 
Target End:1528 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000276433 
Target:MDP0000263925 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000263925 
Target:MDP0000380605 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000380605 
Target:MDP0000165817 
Target Start:111 
Target End:130 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000165817 
Target:MDP0000295324 
Target Start:801 
Target End:820 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGUUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000295324 
Target:MDP0000606853 
Target Start:10 
Target End:29 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGUUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000606853 
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000252675 
Target Start:209 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:270 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000148472 
Target Start:423 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGUU -5' 
Inhibition Type:Cleavage 
MDP0000148472 
Target:MDP0000321461 
Target Start:503 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:887 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000249678 
Target Start:40 
Target End:60 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1120 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1501 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGAAG -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1858 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000213489 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
MDP0000213489 
Target:MDP0000258116 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000323014 
Target Start:19 
Target End:39 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAGG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Target:MDP0000191749 
Target Start:1428 
Target End:1448 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000934866 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000934866 
Target:MDP0000305861 
Target Start:3583 
Target End:3604 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCACUAGAGUASCUAAG -5' 
Inhibition Type:Cleavage 
MDP0000305861 
Target:MDP0000508371 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000508371 
Target:MDP0000717558 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000717558 
Target:MDP0000278249 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000278249 
Target:MDP0000900762 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
MDP0000900762 
Target:MDP0000249678 
Target Start:40 
Target End:60 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1122 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1503 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1860 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000213489 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
MDP0000213489 
Target:MDP0000258116 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000191749 
Target Start:1428 
Target End:1448 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000934866 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000934866 
Target:MDP0000323014 
Target Start:20 
Target End:39 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Target:MDP0000305861 
Target Start:3585 
Target End:3604 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCACUAGAGUASCUA -5' 
Inhibition Type:Cleavage 
MDP0000305861 
Target:MDP0000249678 
Target Start:39 
Target End:60 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAGA -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1122 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1503 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1860 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000191749 
Target Start:1427 
Target End:1448 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAGA -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000213489 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
MDP0000213489 
Target:MDP0000258116 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000934866 
Target Start:925 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUAAA -5' 
Inhibition Type:Cleavage 
MDP0000934866 
Target:MDP0000323014 
Target Start:19 
Target End:39 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAGG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Target:MDP0000251484 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000005879 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000005879 
Target:MDP0000242861 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2700 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Translation 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000148472 
Target Start:424 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000148472 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000422421 
Target Start:664 
Target End:683 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
MDP0000422421 
Target:MDP0000189383 
Target Start:853 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
MDP0000189383 
Target:MDP0000173178 
Target Start:853 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
MDP0000173178 
Target:MDP0000708927 
Target Start:577 
Target End:597 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCACU-3' 
Target Aligned Fragment:3'- GGCUCGGUUUGGUUAGAGUGG -5' 
Inhibition Type:Cleavage 
MDP0000708927 
Target:MDP0000153068 
Target Start:1298 
Target End:1318 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCACU-3' 
Target Aligned Fragment:3'- UACUUGGUUUGGUUUUCGUGG -5' 
Inhibition Type:Cleavage 
MDP0000153068 
Target:MDP0000285731 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCAC-3' 
Target Aligned Fragment:3'- GACUCGGCUUGUUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000285731 
Target:MDP0000589558 
Target Start:991 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000263766 
Target Start:955 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1027 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1027 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1075 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1021 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000146640 
Target Start:1078 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1078 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000322647 
Target Start:1006 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000142582 
Target Start:781 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000276433 
Target Start:1508 
Target End:1528 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000276433 
Target:MDP0000380605 
Target Start:662 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000380605 
Target:MDP0000263925 
Target Start:662 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000263925 
Target:MDP0000165817 
Target Start:110 
Target End:130 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000165817 
Target:MDP0000209716 
Target Start:564 
Target End:583 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000209716 
Target:MDP0000349942 
Target Start:290 
Target End:310 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- GUUGUCUUCGCUCACUCGAGU -5' 
Inhibition Type:Translation 
MDP0000349942 
Target:MDP0000176447 
Target Start:474 
Target End:493 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000176447 
Target:MDP0000336000 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000336000 
Target:MDP0000289282 
Target Start:459 
Target End:478 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACAUACACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000289282 
Target:MDP0000260932 
Target Start:1330 
Target End:1349 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACACACAU -5' 
Inhibition Type:Cleavage 
MDP0000260932 
Target:MDP0000356382 
Target Start:28 
Target End:47 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ASACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000356382 
Target:MDP0000368225 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACACACAUACAC -5' 
Inhibition Type:Cleavage 
MDP0000368225 
Target:MDP0000214924 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACAUACACACACGCACAC -5' 
Inhibition Type:Cleavage 
MDP0000214924 
Target:MDP0000477064 
Target Start:2168 
Target End:2187 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- CUACACACACACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000477064 
Target:MDP0000153003 
Target Start:1587 
Target End:1606 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- UCACACACAUACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000153003 
Target:MDP0000773784 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACGCACACACACAG -5' 
Inhibition Type:Cleavage 
MDP0000773784 
Target:MDP0000144861 
Target Start:1243 
Target End:1262 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACAUACACACAUAA -5' 
Inhibition Type:Cleavage 
MDP0000144861 
Target:MDP0000258998 
Target Start:4074 
Target End:4093 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- AUAUAUACACACACACAUAC -5' 
Inhibition Type:Cleavage 
MDP0000258998 
Target:MDP0000219003 
Target Start:2155 
Target End:2174 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACGCGUACACAUACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000219003 
Target:MDP0000290270 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- AUGUACACGCACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000290270 
Target:MDP0000580724 
Target Start:758 
Target End:777 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACAUACACAUACACAUACAU -5' 
Inhibition Type:Cleavage 
MDP0000580724 
Target:MDP0000368984 
Target Start:10 
Target End:29 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACGAACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000368984 
Target:MDP0000746077 
Target Start:156 
Target End:175 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- CCACACGUACACACAUACAC -5' 
Inhibition Type:Cleavage 
MDP0000746077 
Target:MDP0000231452 
Target Start:407 
Target End:426 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACGCAAACACACAUACACAC -5' 
Inhibition Type:Cleavage 
MDP0000231452 
Target:MDP0000120462 
Target Start:1580 
Target End:1599 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- GUACACAAACACACACACAC -5' 
Inhibition Type:Cleavage 
MDP0000120462 
Target:MDP0000172751 
Target Start:187 
Target End:206 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACAUAUACAUAUACACAUAC -5' 
Inhibition Type:Cleavage 
MDP0000172751 
Target:MDP0000151934 
Target Start:343 
Target End:362 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACAUAUACAAACACAC -5' 
Inhibition Type:Cleavage 
MDP0000151934 
Target:MDP0000283858 
Target Start:3931 
Target End:3950 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- CCACACGCACACGCACAUAU -5' 
Inhibition Type:Cleavage 
MDP0000283858 
Target:MDP0000157943 
Target Start:1596 
Target End:1615 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- AAACACACACCCACACACAC -5' 
Inhibition Type:Translation 
MDP0000157943 
Target:MDP0000649508 
Target Start:1777 
Target End:1796 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACAUACCCACAUGCACAC -5' 
Inhibition Type:Translation 
MDP0000649508 
Target:MDP0000289669 
Target Start:1056 
Target End:1075 
miRNA Aligned Fragment:5'-UGUGUGUGUGUGUGUGUGUG-3' 
Target Aligned Fragment:3'- ACACACACACAGACAUGUAC -5' 
Inhibition Type:Cleavage 
MDP0000289669 
Target:MDP0000133817 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000133817 
Target:MDP0000143276 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000143276 
Target:MDP0000124555 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000124555 
Target:MDP0000578193 
Target Start:310 
Target End:331 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000578193 
Target:MDP0000145557 
Target Start:2341 
Target End:2362 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000145557 
Target:MDP0000193637 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000193637 
Target:MDP0000642761 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000642761 
Target:MDP0000226215 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000226215 
Target:MDP0000253904 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000253904 
Target:MDP0000931057 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000931057 
Target:MDP0000650225 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000650225 
Target:MDP0000167314 
Target Start:343 
Target End:364 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000167314 
Target:MDP0000264051 
Target Start:340 
Target End:361 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000264051 
Target:MDP0000581761 
Target Start:148 
Target End:169 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGGACGACUCUACUCAUAAGGU -5' 
Inhibition Type:Translation 
MDP0000581761 
Target:MDP0000164048 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCGCAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000164048 
Target:MDP0000268980 
Target Start:973 
Target End:994 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGGACGAGUUCACUCUUAAGGU -5' 
Inhibition Type:Translation 
MDP0000268980 
Target:MDP0000317209 
Target Start:322 
Target End:343 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUGACUAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000317209 
Target:MDP0000475808 
Target Start:232 
Target End:253 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUGACUAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000475808 
Target:MDP0000726027 
Target Start:339 
Target End:358 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUC-3' 
Target Aligned Fragment:3'- AGAAGGAGUUUACUCAAAAG -5' 
Inhibition Type:Cleavage 
MDP0000726027 
Target:MDP0000378930 
Target Start:612 
Target End:631 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000378930 
Target:MDP0000314565 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000314565 
Target:MDP0000410502 
Target Start:81 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000410502 
Target:MDP0000605598 
Target Start:168 
Target End:187 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000605598 
Target:MDP0000433167 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000433167 
Target:MDP0000222077 
Target Start:93 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000222077 
Target:MDP0000317856 
Target Start:81 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGRAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000317856 
Target:MDP0000220580 
Target Start:93 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000220580 
Target:MDP0000193014 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000193014 
Target:MDP0000277868 
Target Start:63 
Target End:82 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000277868 
Target:MDP0000400164 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000400164 
Target:MDP0000278543 
Target Start:822 
Target End:841 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000278543 
Target:MDP0000661138 
Target Start:453 
Target End:472 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCAUAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000661138 
Target:MDP0000601632 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000601632 
Target:MDP0000946278 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000946278 
Target:MDP0000297707 
Target Start:1719 
Target End:1738 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- GCGCUCACAGAAGUGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000297707 
Target:MDP0000216668 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000216668 
Target:MDP0000637513 
Target Start:579 
Target End:598 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGYGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000637513 
Target:MDP0000150743 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000150743 
Target:MDP0000724111 
Target Start:87 
Target End:106 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCACACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000724111 
Target:MDP0000634037 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAUGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000634037 
Target:MDP0000694809 
Target Start:66 
Target End:85 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000694809 
Target:MDP0000525273 
Target Start:60 
Target End:79 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000525273 
Target:MDP0000506162 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000506162 
Target:MDP0000458576 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCGCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000458576 
Target:MDP0000750392 
Target Start:1764 
Target End:1783 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
MDP0000750392 
Target:MDP0000120635 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACAUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000131481 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACAUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000131481 
Target:MDP0000221322 
Target Start:1596 
Target End:1615 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACAUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000221322 
Target:MDP0000273491 
Target Start:300 
Target End:319 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGG -5' 
Inhibition Type:Cleavage 
MDP0000273491 
Target:MDP0000232116 
Target Start:1302 
Target End:1321 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGG -5' 
Inhibition Type:Cleavage 
MDP0000232116 
Target:MDP0000256621 
Target Start:1611 
Target End:1630 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- CGGACCGAGGGACGUACGGG -5' 
Inhibition Type:Cleavage 
MDP0000256621 
Target:MDP0000167989 
Target Start:58 
Target End:78 
miRNA Aligned Fragment:5'-GCCUGGCUCCCUGUAUGCCAU-3' 
Target Aligned Fragment:3'- CGGAUCGAGGGAUGAACGGUG -5' 
Inhibition Type:Cleavage 
MDP0000167989 
Target:MDP0000378930 
Target Start:611 
Target End:631 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000378930 
Target:MDP0000314565 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000314565 
Target:MDP0000410502 
Target Start:80 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000410502 
Target:MDP0000605598 
Target Start:167 
Target End:187 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000605598 
Target:MDP0000433167 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000433167 
Target:MDP0000222077 
Target Start:92 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000222077 
Target:MDP0000317856 
Target Start:80 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGRAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000317856 
Target:MDP0000220580 
Target Start:92 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000220580 
Target:MDP0000193014 
Target Start:74 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000193014 
Target:MDP0000277868 
Target Start:62 
Target End:82 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000277868 
Target:MDP0000400164 
Target Start:74 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000400164 
Target:MDP0000278543 
Target Start:821 
Target End:841 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000278543 
Target:MDP0000661138 
Target Start:452 
Target End:472 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCAUAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000661138 
Target:MDP0000601632 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000601632 
Target:MDP0000946278 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000946278 
Target:MDP0000297707 
Target Start:1718 
Target End:1738 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- GCGCUCACAGAAGUGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000297707 
Target:MDP0000216668 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000216668 
Target:MDP0000637513 
Target Start:578 
Target End:598 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGYGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000637513 
Target:MDP0000150743 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000150743 
Target:MDP0000724111 
Target Start:86 
Target End:106 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCACACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000724111 
Target:MDP0000634037 
Target Start:50 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAUGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000634037 
Target:MDP0000694809 
Target Start:65 
Target End:85 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000694809 
Target:MDP0000525273 
Target Start:59 
Target End:79 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000525273 
Target:MDP0000506162 
Target Start:50 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000506162 
Target:MDP0000458576 
Target Start:74 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCGCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000458576 
Target:MDP0000249678 
Target Start:40 
Target End:61 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AAGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1122 
Target End:1142 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1503 
Target End:1523 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1860 
Target End:1880 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1525 
Target End:1544 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGA-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACA -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGA-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAGCGUAACA -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000258116 
Target Start:473 
Target End:493 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UGGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000191749 
Target Start:1428 
Target End:1449 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- UAGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000323014 
Target Start:20 
Target End:40 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- UAGGUUUCCCUAUCGU-ACUAG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Target:MDP0000305861 
Target Start:3585 
Target End:3605 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCACUAGAGUASCUA -5' 
Inhibition Type:Translation 
MDP0000305861 
Target:MDP0000250551 
Target Start:1971 
Target End:1991 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCUCUAUAGUAGCUG -5' 
Inhibition Type:Cleavage 
MDP0000250551 
Target:MDP0000184737 
Target Start:1867 
Target End:1887 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCUCUUGGGUAAUUG -5' 
Inhibition Type:Cleavage 
MDP0000184737 
Target:MDP0000198007 
Target Start:1867 
Target End:1887 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCUCUUGGGUAAUUG -5' 
Inhibition Type:Cleavage 
MDP0000198007 
Target:MDP0000395030 
Target Start:5910 
Target End:5930 
miRNA Aligned Fragment:5'-AUCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- UAGGUUUCUCUAUAGUAGCUG -5' 
Inhibition Type:Cleavage 
MDP0000395030 
Target:MDP0000251484 
Target Start:607 
Target End:626 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:553 
Target End:572 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000242861 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:589 
Target End:608 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:589 
Target End:608 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:568 
Target End:587 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2700 
Target End:2720 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Cleavage 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:423 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GAGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000161945 
Target Start:236 
Target End:255 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAACCUGGUUCGAAGUAAGA -5' 
Inhibition Type:Cleavage 
MDP0000161945 
Target:MDP0000774802 
Target Start:7 
Target End:26 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAGUUUGGUCAGAGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000774802 
Target:MDP0000301081 
Target Start:1318 
Target End:1337 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GGGCCUGGUUUGAACUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000301081 
Target:MDP0000305463 
Target Start:380 
Target End:399 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAGCUUGGACAGAAGUAAGG -5' 
Inhibition Type:Translation 
MDP0000305463 
Target:MDP0000310981 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACG -5' 
Inhibition Type:Cleavage 
MDP0000310981 
Target:MDP0000911724 
Target Start:645 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUU -5' 
Inhibition Type:Cleavage 
MDP0000911724 
Target:MDP0000121265 
Target Start:645 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUU -5' 
Inhibition Type:Cleavage 
MDP0000121265 
Target:MDP0000298182 
Target Start:618 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACG -5' 
Inhibition Type:Cleavage 
MDP0000298182 
Target:MDP0000528658 
Target Start:528 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACG -5' 
Inhibition Type:Cleavage 
MDP0000528658 
Target:MDP0000269941 
Target Start:24 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGCA-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUUCACGU -5' 
Inhibition Type:Cleavage 
MDP0000269941 
Target:MDP0000129335 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GUCUUUUCGUCCUGUGCACU -5' 
Inhibition Type:Cleavage 
MDP0000129335 
Target:MDP0000232050 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GUCUUUUCGUCCUGUGCACU -5' 
Inhibition Type:Cleavage 
MDP0000232050 
Target:MDP0000271887 
Target Start:95 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACG -5' 
Inhibition Type:Cleavage 
MDP0000271887 
Target:MDP0000276765 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GCCUCUUCGUGCUGUGCACU -5' 
Inhibition Type:Translation 
MDP0000276765 
Target:MDP0000231813 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUCUACU -5' 
Inhibition Type:Cleavage 
MDP0000231813 
Target:MDP0000283465 
Target Start:2739 
Target End:2759 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGCA-3' 
Target Aligned Fragment:3'- ACCUCUUGGUCCCGUAAACGU -5' 
Inhibition Type:Cleavage 
MDP0000283465 
Target:MDP0000296582 
Target Start:1092 
Target End:1111 
miRNA Aligned Fragment:5'-UGAAGCUGCCAGCAUGAUCU-3' 
Target Aligned Fragment:3'- ACUUUGAUUGUCGUACUCGA -5' 
Inhibition Type:Translation 
MDP0000296582 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000148472 
Target Start:424 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000148472 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000422421 
Target Start:663 
Target End:683 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
MDP0000422421 
Target:MDP0000173178 
Target Start:852 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
MDP0000173178 
Target:MDP0000189383 
Target Start:852 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
MDP0000189383 
Target:MDP0000153001 
Target Start:1060 
Target End:1080 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UUUUAGAACUAGUAUGAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000153001 
Target:MDP0000233315 
Target Start:1570 
Target End:1590 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UUUUAGAACUAGUAUGAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000233315 
Target:MDP0000442611 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000162193 
Target Start:1038 
Target End:1058 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUACCUUGGAGGA -5' 
Inhibition Type:Translation 
MDP0000162193 
Target:MDP0000950533 
Target Start:2881 
Target End:2901 
miRNA Aligned Fragment:5'-AAGCUCAGGAGGGAUAGCGCC-3' 
Target Aligned Fragment:3'- UUCGAGUUCUUCUUGUUGUGG -5' 
Inhibition Type:Cleavage 
MDP0000950533 
Target:MDP0000353698 
Target Start:65 
Target End:84 
miRNA Aligned Fragment:5'-AAGCUCAGGAGGGAUAGCGC-3' 
Target Aligned Fragment:3'- AUCGAGUCCUCCCUAUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000353698 
Target:MDP0000158644 
Target Start:181 
Target End:201 
miRNA Aligned Fragment:5'-AAGCUCAGGAGGGAUAGCGCC-3' 
Target Aligned Fragment:3'- UUCGAGUCCUCCUUGUCAAGG -5' 
Inhibition Type:Cleavage 
MDP0000158644 
Target:MDP0000166076 
Target Start:214 
Target End:234 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGAGUYCAACGGGGAC -5' 
Inhibition Type:Cleavage 
MDP0000166076 
Target:MDP0000821430 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000821430 
Target:MDP0000217046 
Target Start:24 
Target End:45 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000217046 
Target:MDP0000530255 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000530255 
Target:MDP0000691261 
Target Start:317 
Target End:336 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- UCACGAGAGCUCAGCGGGGA -5' 
Inhibition Type:Translation 
MDP0000691261 
Target:MDP0000148985 
Target Start:241 
Target End:260 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- ACACAAGAGUUUAGGGGCGA -5' 
Inhibition Type:Cleavage 
MDP0000148985 
Target:MDP0000885534 
Target Start:849 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
MDP0000885534 
Target:MDP0000263881 
Target Start:1620 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
MDP0000263881 
Target:MDP0000183865 
Target Start:438 
Target End:457 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGA -5' 
Inhibition Type:Cleavage 
MDP0000183865 
Target:MDP0000164531 
Target Start:915 
Target End:934 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGA -5' 
Inhibition Type:Cleavage 
MDP0000164531 
Target:MDP0000279028 
Target Start:963 
Target End:982 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGA -5' 
Inhibition Type:Cleavage 
MDP0000279028 
Target:MDP0000375005 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000375005 
Target:MDP0000314593 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGM -5' 
Inhibition Type:Cleavage 
MDP0000314593 
Target:MDP0000146933 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000146933 
Target:MDP0000296077 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000296077 
Target:MDP0000778477 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000778477 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000208739 
Target Start:320 
Target End:340 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCAC-3' 
Target Aligned Fragment:3'- AUUAAGAACUACGACGACGUG -5' 
Inhibition Type:Cleavage 
MDP0000208739 
Target:MDP0000170673 
Target Start:14 
Target End:33 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUUAGAACUACUAGGACUA -5' 
Inhibition Type:Cleavage 
MDP0000170673 
Target:MDP0000424651 
Target Start:1658 
Target End:1677 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUUAGAAGAACUACGACGG -5' 
Inhibition Type:Translation 
MDP0000424651 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000302021 
Target Start:516 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGU -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000506954 
Target Start:263 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
MDP0000506954 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000138865 
Target Start:863 
Target End:882 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGU -5' 
Inhibition Type:Translation 
MDP0000138865 
Target:MDP0000123673 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGU -5' 
Inhibition Type:Translation 
MDP0000123673 
Target:MDP0000285150 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000378930 
Target Start:3402 
Target End:3421 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGAGGAAUUACGACGU -5' 
Inhibition Type:Translation 
MDP0000378930 
Target:MDP0000311595 
Target Start:1574 
Target End:1593 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
MDP0000311595 
Target:MDP0000442611 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000162193 
Target Start:1039 
Target End:1058 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- AACCUGACUUACCUUGGAGG -5' 
Inhibition Type:Translation 
MDP0000162193 
Target:MDP0000200319 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000302021 
Target Start:515 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGUC -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000252675 
Target Start:209 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:270 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000123673 
Target Start:955 
Target End:975 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGUC -5' 
Inhibition Type:Translation 
MDP0000123673 
Target:MDP0000506954 
Target Start:262 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000506954 
Target:MDP0000321461 
Target Start:503 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000138865 
Target Start:862 
Target End:882 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGUU -5' 
Inhibition Type:Translation 
MDP0000138865 
Target:MDP0000186465 
Target Start:377 
Target End:396 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000186465 
Target:MDP0000216976 
Target Start:422 
Target End:441 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000216976 
Target:MDP0000253886 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000237596 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000237596 
Target:MDP0000319634 
Target Start:587 
Target End:606 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000319634 
Target:MDP0000265425 
Target Start:418 
Target End:437 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
MDP0000265425 
Target:MDP0000229368 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
MDP0000229368 
Target:MDP0000262512 
Target Start:254 
Target End:273 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUGAAUUUCUUCUAGG -5' 
Inhibition Type:Translation 
MDP0000262512 
Target:MDP0000162193 
Target Start:1040 
Target End:1059 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUGACUUACCUUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000162193 
Target:MDP0000186465 
Target Start:377 
Target End:396 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000186465 
Target:MDP0000216976 
Target Start:422 
Target End:441 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000216976 
Target:MDP0000253886 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000162193 
Target Start:1039 
Target End:1059 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GAACCUGACUUACCUUGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000162193 
Target:MDP0000237596 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000237596 
Target:MDP0000319634 
Target Start:587 
Target End:606 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000319634 
Target:MDP0000265425 
Target Start:418 
Target End:437 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
MDP0000265425 
Target:MDP0000229368 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
MDP0000229368 
Target:MDP0000333896 
Target Start:116 
Target End:136 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- GUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000333896 
Target:MDP0000323007 
Target Start:11 
Target End:31 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- GUGUGUGUGUGUGURUGUSUG -5' 
Inhibition Type:Cleavage 
MDP0000323007 
Target:MDP0000155674 
Target Start:2040 
Target End:2060 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- GUAUGUGUAUGUGUGUGUGUG -5' 
Inhibition Type:Translation 
MDP0000155674 
Target:MDP0000191468 
Target Start:150 
Target End:170 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- UUGUGUGUGUGUGUAUGCGUG -5' 
Inhibition Type:Cleavage 
MDP0000191468 
Target:MDP0000314244 
Target Start:160 
Target End:180 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- GUGUGUGUGUUUGUAUUUGUG -5' 
Inhibition Type:Translation 
MDP0000314244 
Target:MDP0000178691 
Target Start:600 
Target End:620 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- GUAGGUGUUUGUGUGUGUGUG -5' 
Inhibition Type:Translation 
MDP0000178691 
Target:MDP0000324833 
Target Start:103 
Target End:122 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- UUUUGUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000324833 
Target:MDP0000512381 
Target Start:347 
Target End:367 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACAC-3' 
Target Aligned Fragment:3'- GUGUGUGCGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
MDP0000512381 
Target:MDP0000306141 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- GUUUGUGUGUGUGUGUGUCU -5' 
Inhibition Type:Cleavage 
MDP0000306141 
Target:MDP0000317247 
Target Start:256 
Target End:275 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- GUGAGUGUGUGGGUAUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000317247 
Target:MDP0000266900 
Target Start:708 
Target End:727 
miRNA Aligned Fragment:5'-CAUACACACACACAUACACA-3' 
Target Aligned Fragment:3'- GUGUGUGUGGGUGUGUGUAU -5' 
Inhibition Type:Translation 
MDP0000266900 
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000321461 
Target Start:503 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000487399 
Target Start:314 
Target End:334 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UUUUACGACUACUAUGAUGUU -5' 
Inhibition Type:Cleavage 
MDP0000487399 
Target:MDP0000233135 
Target Start:185 
Target End:205 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UUUUACGACUACUAUGAUGUU -5' 
Inhibition Type:Cleavage 
MDP0000233135 
Target:MDP0000285150 
Target Start:887 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000515187 
Target Start:29 
Target End:48 
miRNA Aligned Fragment:5'-AGAAUCCUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UUUUAGGAGUACUGCGACGA -5' 
Inhibition Type:Translation 
MDP0000515187 
Target:MDP0000261181 
Target Start:46 
Target End:65 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000261181 
Target:MDP0000147872 
Target Start:232 
Target End:251 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUAAACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000147872 
Target:MDP0000196131 
Target Start:367 
Target End:386 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUAAACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000196131 
Target:MDP0000667488 
Target Start:2505 
Target End:2525 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- CGACGUGGACUUGGACGUGGU -5' 
Inhibition Type:Translation 
MDP0000667488 
Target:MDP0000578751 
Target Start:1080 
Target End:1100 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- CGACGUGGACUUGGACGUGGU -5' 
Inhibition Type:Translation 
MDP0000578751 
Target:MDP0000198217 
Target Start:727 
Target End:746 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGUCGUGGACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000198217 
Target:MDP0000183627 
Target Start:1227 
Target End:1247 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGACGUGGWCGUUGACGUGGY -5' 
Inhibition Type:Cleavage 
MDP0000183627 
Target:MDP0000270855 
Target Start:1086 
Target End:1106 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGACGUGGWCGUUGACGUGGY -5' 
Inhibition Type:Cleavage 
MDP0000270855 
Target:MDP0000179855 
Target Start:678 
Target End:698 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGACGUGAACGUGAACGUGGU -5' 
Inhibition Type:Cleavage 
MDP0000179855 
Target:MDP0000120635 
Target Start:382 
Target End:401 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGAACGUGU -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000171737 
Target Start:363 
Target End:383 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- AGACGUAGACGUAGACGUAGU -5' 
Inhibition Type:Cleavage 
MDP0000171737 
Target:MDP0000324028 
Target Start:2 
Target End:22 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGASGUGGAGGUGGAGGUGGU -5' 
Inhibition Type:Translation 
MDP0000324028 
Target:MDP0000193325 
Target Start:1633 
Target End:1652 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GAACGUGGACGUGAACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000193325 
Target:MDP0000315677 
Target Start:40 
Target End:59 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGGAGGUCG -5' 
Inhibition Type:Cleavage 
MDP0000315677 
Target:MDP0000333896 
Target Start:116 
Target End:137 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000333896 
Target:MDP0000323007 
Target Start:13 
Target End:34 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGUGURUGUS -5' 
Inhibition Type:Cleavage 
MDP0000323007 
Target:MDP0000155674 
Target Start:2036 
Target End:2057 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UGUGUAUGUGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
MDP0000155674 
Target:MDP0000333748 
Target Start:34 
Target End:55 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- CAUGCAUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000333748 
Target:MDP0000512381 
Target Start:346 
Target End:366 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UGUGUGCGUGUGUGUGUAUGU -5' 
Inhibition Type:Cleavage 
MDP0000512381 
Target:MDP0000267175 
Target Start:67 
Target End:88 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUAUCUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000267175 
Target:MDP0000219846 
Target Start:166 
Target End:186 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UAUGUAGGUGUGUGUAUAUGU -5' 
Inhibition Type:Cleavage 
MDP0000219846 
Target:MDP0000324833 
Target Start:99 
Target End:119 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUCUCU -5' 
Inhibition Type:Cleavage 
MDP0000324833 
Target:MDP0000266900 
Target Start:707 
Target End:726 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUAC-3' 
Target Aligned Fragment:3'- UGUGUGUGGGUGUGUGUAUA -5' 
Inhibition Type:Translation 
MDP0000266900 
Target:MDP0000292704 
Target Start:1741 
Target End:1760 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUAC-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGAGAAUG -5' 
Inhibition Type:Cleavage 
MDP0000292704 
Target:MDP0000291837 
Target Start:717 
Target End:739 
miRNA Aligned Fragment:5'-AUACAUACAC-ACACACAUACAC-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUUGUGUGUAUGAG -5' 
Inhibition Type:Translation 
MDP0000291837 
Target:MDP0000294811 
Target Start:2453 
Target End:2473 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UAUGUAUGUUUAUCUGUAUGU -5' 
Inhibition Type:Translation 
MDP0000294811 
Target:MDP0000200319 
Target Start:1259 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000204900 
Target Start:1520 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000163645 
Target Start:1259 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCAUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000137561 
Target Start:1634 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGCC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000296716 
Target Start:1253 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUCAUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000130802 
Target Start:1286 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUUAUC -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000302021 
Target Start:512 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGUCUUC -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000217490 
Target Start:2530 
Target End:2549 
miRNA Aligned Fragment:5'-GGUCAUGCUCUGACAGCCUC-3' 
Target Aligned Fragment:3'- CUGGUGUGAGACUGUCUGAG -5' 
Inhibition Type:Cleavage 
MDP0000217490 
Target:MDP0000315449 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCACA-3' 
Target Aligned Fragment:3'- CACUUUAGUAGUUGUAAGUGU -5' 
Inhibition Type:Cleavage 
MDP0000315449 
Target:MDP0000187052 
Target Start:879 
Target End:899 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCACA-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCUAAAUUU -5' 
Inhibition Type:Cleavage 
MDP0000187052 
Target:MDP0000276570 
Target Start:1003 
Target End:1022 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCCAAGUU -5' 
Inhibition Type:Cleavage 
MDP0000276570 
Target:MDP0000257662 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000257662 
Target:MDP0000772107 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000772107 
Target:MDP0000293297 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000293297 
Target:MDP0000863027 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000863027 
Target:MDP0000498407 
Target Start:1564 
Target End:1583 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000498407 
Target:MDP0000181606 
Target Start:1250 
Target End:1269 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1275 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1542 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1656 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000130613 
Target Start:405 
Target End:424 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- AUUAGAACUACUACAGUGUA -5' 
Inhibition Type:Cleavage 
MDP0000130613 
Target:MDP0000181606 
Target Start:1251 
Target End:1272 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1278 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000281079 
Target Start:1290 
Target End:1311 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000285955 
Target Start:1290 
Target End:1311 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1290 
Target End:1311 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000204900 
Target Start:1524 
Target End:1545 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1659 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000200319 
Target Start:1263 
Target End:1284 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1263 
Target End:1284 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCCCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000321461 
Target Start:504 
Target End:525 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:888 
Target End:909 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000430527 
Target Start:99 
Target End:118 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
MDP0000430527 
Target:MDP0000176154 
Target Start:99 
Target End:118 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
MDP0000176154 
Target:MDP0000180310 
Target Start:450 
Target End:469 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
MDP0000180310 
Target:MDP0000122126 
Target Start:450 
Target End:469 
miRNA Aligned Fragment:5'-UGAGAAUCUUGAUGAUGCUG-3' 
Target Aligned Fragment:3'- ACUCUUAGAACUAUUAUGUA -5' 
Inhibition Type:Cleavage 
MDP0000122126 
Target:MDP0000663084 
Target Start:543 
Target End:562 
miRNA Aligned Fragment:5'-AGACUACAAUUAUCUGAUCA-3' 
Target Aligned Fragment:3'- UCUGGUGUUAGUAUAUUAGU -5' 
Inhibition Type:Cleavage 
MDP0000663084 
Target:MDP0000670775 
Target Start:543 
Target End:562 
miRNA Aligned Fragment:5'-AGACUACAAUUAUCUGAUCA-3' 
Target Aligned Fragment:3'- UCUGGUGUUAGUAUAUUAGU -5' 
Inhibition Type:Cleavage 
MDP0000670775 
Target:MDP0000224745 
Target Start:141 
Target End:160 
miRNA Aligned Fragment:5'-AGACUACAAUUAUCUGAUCA-3' 
Target Aligned Fragment:3'- UCUGGUGUUAAGAGAAUGGU -5' 
Inhibition Type:Cleavage 
MDP0000224745 
Target:MDP0000750392 
Target Start:1764 
Target End:1784 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCCA-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
MDP0000750392 
Target:MDP0000120635 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000131481 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000131481 
Target:MDP0000221322 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000221322 
Target:MDP0000273491 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000273491 
Target:MDP0000232116 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000232116 
Target:MDP0000256621 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000256621 
Target:MDP0000310751 
Target Start:554 
Target End:574 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCCA-3' 
Target Aligned Fragment:3'- GCGGAACGAGGAACAUACGAU -5' 
Inhibition Type:Cleavage 
MDP0000310751 
Target:MDP0000206446 
Target Start:551 
Target End:571 
miRNA Aligned Fragment:5'-UGCCUGGCUCCUUGUAUGCCA-3' 
Target Aligned Fragment:3'- ACGGACCGGUGAACGAACGGU -5' 
Inhibition Type:Translation 
MDP0000206446 
Target:MDP0000130347 
Target Start:203 
Target End:225 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAAGAGAAGGAGACGUGAGAGA -5' 
Inhibition Type:Cleavage 
MDP0000130347 
Target:MDP0000587576 
Target Start:69 
Target End:91 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAAGAGAAGGAGACGUGAGAGA -5' 
Inhibition Type:Cleavage 
MDP0000587576 
Target:MDP0000294788 
Target Start:1977 
Target End:1999 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- AUAGAAGAAGAAGAUGUGAAAAG -5' 
Inhibition Type:Cleavage 
MDP0000294788 
Target:MDP0000874953 
Target Start:894 
Target End:916 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAGAAGAAGAAGUAGUGAUAAA -5' 
Inhibition Type:Cleavage 
MDP0000874953 
Target:MDP0000633365 
Target Start:362 
Target End:384 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAAGAGAAGGAGACGUGAAAGG -5' 
Inhibition Type:Cleavage 
MDP0000633365 
Target:MDP0000219210 
Target Start:275 
Target End:297 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- GUAGAAGAAGAAGAAGUGAUGAA -5' 
Inhibition Type:Cleavage 
MDP0000219210 
Target:MDP0000937986 
Target Start:150 
Target End:172 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CCAGAAGAAGAAGAAGUGGUAGA -5' 
Inhibition Type:Cleavage 
MDP0000937986 
Target:MDP0000171272 
Target Start:685 
Target End:706 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUU-3' 
Target Aligned Fragment:3'- GUAAGAGAAGGAGGUGUGAUAA -5' 
Inhibition Type:Cleavage 
MDP0000171272 
Target:MDP0000273365 
Target Start:1304 
Target End:1326 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000273365 
Target:MDP0000305976 
Target Start:1301 
Target End:1323 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000305976 
Target:MDP0000124536 
Target Start:1139 
Target End:1161 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000124536 
Target:MDP0000945492 
Target Start:1139 
Target End:1161 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000945492 
Target:MDP0000168773 
Target Start:761 
Target End:783 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000168773 
Target:MDP0000704958 
Target Start:323 
Target End:345 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000704958 
Target:MDP0000901457 
Target Start:17 
Target End:39 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- CUAGAAGAAGGAGACGUGGUCAA -5' 
Inhibition Type:Cleavage 
MDP0000901457 
Target:MDP0000272336 
Target Start:17 
Target End:39 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAAAAGAAGAAGGAGUGAAAGG -5' 
Inhibition Type:Cleavage 
MDP0000272336 
Target:MDP0000217443 
Target Start:1640 
Target End:1662 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAAAAGAAGAAGGAGUGAAAGG -5' 
Inhibition Type:Cleavage 
MDP0000217443 
Target:MDP0000169841 
Target Start:26 
Target End:48 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAAAAGAAGAAGGAGUGAAAGG -5' 
Inhibition Type:Cleavage 
MDP0000169841 
Target:MDP0000663428 
Target Start:960 
Target End:982 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- ACAGAAGAAGGAGGAGUGAUGGG -5' 
Inhibition Type:Cleavage 
MDP0000663428 
Target:MDP0000592916 
Target Start:408 
Target End:430 
miRNA Aligned Fragment:5'-UGUUUUCUUCUUCUGCACUAUUU-3' 
Target Aligned Fragment:3'- GUAAAAGAAGAAGAAGUGAAAGA -5' 
Inhibition Type:Cleavage 
MDP0000592916 
Target:MDP0000784909 
Target Start:1227 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1356 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1380 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1908 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000302855 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
MDP0000302855 
Target:MDP0000240772 
Target Start:1254 
Target End:1274 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCACGUCGUAACUAC -5' 
Inhibition Type:Cleavage 
MDP0000240772 
Target:MDP0000237964 
Target Start:697 
Target End:716 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AGUAACUCGCGUCGCAACUA -5' 
Inhibition Type:Cleavage 
MDP0000237964 
Target:MDP0000126274 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- CAUAACUCACGUCGCAACUA -5' 
Inhibition Type:Cleavage 
MDP0000126274 
Target:MDP0000149146 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- CAUAACUCACGUCGCAACUA -5' 
Inhibition Type:Cleavage 
MDP0000149146 
Target:MDP0000230007 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000230007 
Target:MDP0000500938 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000500938 
Target:MDP0000739375 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000739375 
Target:MDP0000299415 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000299415 
Target:MDP0000192322 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AAUAACUCACGUUGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000192322 
Target:MDP0000226556 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AAUAACUCACGUUGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000226556 
Target:MDP0000174639 
Target Start:449 
Target End:469 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAGCUCCCGUCGCCACUAC -5' 
Inhibition Type:Translation 
MDP0000174639 
Target:MDP0000243556 
Target Start:845 
Target End:865 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- ACUGACUCCCGUCGCAACUAC -5' 
Inhibition Type:Translation 
MDP0000243556 
Target:MDP0000280305 
Target Start:675 
Target End:695 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGCAACUCACGACGCAACUAU -5' 
Inhibition Type:Cleavage 
MDP0000280305 
Target:MDP0000276889 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AGUAACUCACAUUGUGACUA -5' 
Inhibition Type:Translation 
MDP0000276889 
Target:MDP0000307655 
Target Start:681 
Target End:701 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGCAACUCACGACGUAACUAU -5' 
Inhibition Type:Cleavage 
MDP0000307655 
Target:MDP0000252970 
Target Start:681 
Target End:701 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGCAACUCACGACGUAACUAU -5' 
Inhibition Type:Cleavage 
MDP0000252970 
Target:MDP0000742438 
Target Start:2013 
Target End:2033 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCUG-3' 
Target Aligned Fragment:3'- GUGGUUUCUUCUUAAUGUGAU -5' 
Inhibition Type:Cleavage 
MDP0000742438 
Target:MDP0000271176 
Target Start:482 
Target End:501 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCU-3' 
Target Aligned Fragment:3'- AAGGUUUCCUCUUAAUUGGA -5' 
Inhibition Type:Cleavage 
MDP0000271176 
Target:MDP0000159358 
Target Start:3301 
Target End:3321 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCAG-3' 
Target Aligned Fragment:3'- ACCGUUUUCUCGAAACGGGUU -5' 
Inhibition Type:Cleavage 
MDP0000159358 
Target:MDP0000284678 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
MDP0000284678 
Target:MDP0000612779 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
MDP0000612779 
Target:MDP0000326866 
Target Start:140 
Target End:159 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- ACGGUUUCCUCAAAACGCGC -5' 
Inhibition Type:Cleavage 
MDP0000326866 
Target:MDP0000784909 
Target Start:1228 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1357 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1381 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1909 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000302855 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
MDP0000302855 
Target:MDP0000260500 
Target Start:653 
Target End:673 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- GUGUGUGUGUGUGUGUAUAUA -5' 
Inhibition Type:Cleavage 
MDP0000260500 
Target:MDP0000155674 
Target Start:2038 
Target End:2058 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- AUGUGUAUGUGUGUGUGUGUA -5' 
Inhibition Type:Cleavage 
MDP0000155674 
Target:MDP0000323007 
Target Start:15 
Target End:35 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- AUAUGUGUGUGUGUGUGURUG -5' 
Inhibition Type:Cleavage 
MDP0000323007 
Target:MDP0000219846 
Target Start:167 
Target End:187 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- AUAUGUAGGUGUGUGUAUAUG -5' 
Inhibition Type:Cleavage 
MDP0000219846 
Target:MDP0000333896 
Target Start:116 
Target End:136 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- GUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000333896 
Target:MDP0000266900 
Target Start:707 
Target End:727 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- GUGUGUGUGGGUGUGUGUAUA -5' 
Inhibition Type:Translation 
MDP0000266900 
Target:MDP0000267175 
Target Start:66 
Target End:85 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- AUAUCUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000267175 
Target:MDP0000512381 
Target Start:347 
Target End:367 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- GUGUGUGCGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
MDP0000512381 
Target:MDP0000454891 
Target Start:1137 
Target End:1156 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- AUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
MDP0000454891 
Target:MDP0000490509 
Target Start:1146 
Target End:1165 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- AUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
MDP0000490509 
Target:MDP0000356405 
Target Start:91 
Target End:111 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- GUAUGUAUAUAUGUGUAUGUG -5' 
Inhibition Type:Translation 
MDP0000356405 
Target:MDP0000292704 
Target Start:1741 
Target End:1761 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUAU-3' 
Target Aligned Fragment:3'- AUAUGUGUGUGUGUGAGAAUG -5' 
Inhibition Type:Cleavage 
MDP0000292704 
Target:MDP0000336268 
Target Start:170 
Target End:189 
miRNA Aligned Fragment:5'-UAUACAUACACACACAUAUA-3' 
Target Aligned Fragment:3'- GUGUGUAUGUGUGUGUUAAU -5' 
Inhibition Type:Cleavage 
MDP0000336268 
Target:MDP0000240772 
Target Start:1253 
Target End:1272 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGUAACUACU -5' 
Inhibition Type:Cleavage 
MDP0000240772 
Target:MDP0000126274 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000126274 
Target:MDP0000149146 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000149146 
Target:MDP0000243556 
Target Start:844 
Target End:863 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGUCGCAACUACU -5' 
Inhibition Type:Cleavage 
MDP0000243556 
Target:MDP0000237964 
Target Start:695 
Target End:714 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCGCGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000237964 
Target:MDP0000237964 
Target Start:2372 
Target End:2391 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
MDP0000237964 
Target:MDP0000192322 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000192322 
Target:MDP0000226556 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000226556 
Target:MDP0000280305 
Target Start:674 
Target End:693 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
MDP0000280305 
Target:MDP0000175212 
Target Start:785 
Target End:804 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCGCGUCGCAACUAGU -5' 
Inhibition Type:Cleavage 
MDP0000175212 
Target:MDP0000252970 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
MDP0000252970 
Target:MDP0000307655 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
MDP0000307655 
Target:MDP0000212954 
Target Start:203 
Target End:222 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGGCGCAACUACU -5' 
Inhibition Type:Translation 
MDP0000212954 
Target:MDP0000164958 
Target Start:939 
Target End:958 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCAUGUUCCAGCUACU -5' 
Inhibition Type:Cleavage 
MDP0000164958 
Target:MDP0000913030 
Target Start:1361 
Target End:1380 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAAUUUACGUCGUAACCAUU -5' 
Inhibition Type:Cleavage 
MDP0000913030 
Target:MDP0000278159 
Target Start:518 
Target End:537 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- YAACUUACGUCGUAACUCUU -5' 
Inhibition Type:Cleavage 
MDP0000278159 
Target:MDP0000147872 
Target Start:230 
Target End:249 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAAACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
MDP0000147872 
Target:MDP0000196131 
Target Start:365 
Target End:384 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAAACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
MDP0000196131 
Target:MDP0000261181 
Target Start:44 
Target End:63 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGGACGUGGACGUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000261181 
Target:MDP0000233288 
Target Start:1172 
Target End:1191 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGAACGUGGACGUGGUG -5' 
Inhibition Type:Cleavage 
MDP0000233288 
Target:MDP0000193325 
Target Start:1631 
Target End:1650 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGGACGUGAACGUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000193325 
Target:MDP0000198217 
Target Start:725 
Target End:744 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UCGUGGACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
MDP0000198217 
Target:MDP0000837414 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UUGUAAACGUGGGCUUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000837414 
Target:MDP0000291809 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UUGUAAACGUGGGCUUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000291809 
Target:MDP0000301736 
Target Start:5053 
Target End:5072 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAGACGUGGAGGAGGAG -5' 
Inhibition Type:Cleavage 
MDP0000301736 
Target:MDP0000240772 
Target Start:1253 
Target End:1272 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGUAACUACU -5' 
Inhibition Type:Cleavage 
MDP0000240772 
Target:MDP0000126274 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000126274 
Target:MDP0000149146 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000149146 
Target:MDP0000243556 
Target Start:844 
Target End:863 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGUCGCAACUACU -5' 
Inhibition Type:Cleavage 
MDP0000243556 
Target:MDP0000175212 
Target Start:784 
Target End:804 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGAA-3' 
Target Aligned Fragment:3'- CAACUCGCGUCGCAACUAGUU -5' 
Inhibition Type:Cleavage 
MDP0000175212 
Target:MDP0000237964 
Target Start:695 
Target End:714 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCGCGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000237964 
Target:MDP0000237964 
Target Start:2372 
Target End:2391 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
MDP0000237964 
Target:MDP0000192322 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000192322 
Target:MDP0000226556 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000226556 
Target:MDP0000280305 
Target Start:674 
Target End:693 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
MDP0000280305 
Target:MDP0000252970 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
MDP0000252970 
Target:MDP0000307655 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
MDP0000307655 
Target:MDP0000212954 
Target Start:203 
Target End:222 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGGCGCAACUACU -5' 
Inhibition Type:Translation 
MDP0000212954 
Target:MDP0000164958 
Target Start:939 
Target End:958 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCAUGUUCCAGCUACU -5' 
Inhibition Type:Cleavage 
MDP0000164958 
Target:MDP0000142582 
Target Start:782 
Target End:802 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000297978 
Target Start:794 
Target End:814 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000322647 
Target Start:1007 
Target End:1027 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000155354 
Target Start:1136 
Target End:1156 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000249364 
Target Start:2714 
Target End:2734 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000246046 
Target Start:1022 
Target End:1042 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000171877 
Target Start:1076 
Target End:1096 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000193702 
Target Start:1028 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000119458 
Target Start:1028 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000176265 
Target Start:704 
Target End:724 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000170630 
Target Start:770 
Target End:790 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000262141 
Target Start:845 
Target End:865 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000778465 
Target Start:1079 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000146640 
Target Start:1079 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000263766 
Target Start:956 
Target End:976 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000325736 
Target Start:39 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAG-AUAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCGUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000325736 
Target:MDP0000531568 
Target Start:1373 
Target End:1393 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
MDP0000531568 
Target:MDP0000147944 
Target Start:2097 
Target End:2117 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AGCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
MDP0000147944 
Target:MDP0000256388 
Target Start:2151 
Target End:2171 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AGCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
MDP0000256388 
Target:MDP0000266073 
Target Start:2013 
Target End:2033 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AGCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
MDP0000266073 
Target:MDP0000213066 
Target Start:10406 
Target End:10426 
miRNA Aligned Fragment:5'-UUGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
MDP0000213066 
Target:MDP0000552725 
Target Start:109 
Target End:129 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000552725 
Target:MDP0000280968 
Target Start:258 
Target End:278 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- GAACCUAAUUGUCCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000280968 
Target:MDP0000237596 
Target Start:100 
Target End:120 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000237596 
Target:MDP0000319634 
Target Start:586 
Target End:606 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000319634 
Target:MDP0000253886 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000144652 
Target Start:1673 
Target End:1693 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AAACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000144652 
Target:MDP0000141678 
Target Start:1640 
Target End:1660 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AAACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000141678 
Target:MDP0000196238 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000196238 
Target:MDP0000219570 
Target Start:225 
Target End:244 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000219570 
Target:MDP0000174389 
Target Start:991 
Target End:1010 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACUUAAUUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
MDP0000174389 
Target:MDP0000151688 
Target Start:933 
Target End:952 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000151688 
Target:MDP0000175835 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000175835 
Target:MDP0000179306 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAAUUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000179306 
Target:MDP0000562620 
Target Start:2648 
Target End:2667 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AGACCUGACUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
MDP0000562620 
Target:MDP0000312348 
Target Start:582 
Target End:602 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000312348 
Target:MDP0000236327 
Target Start:1047 
Target End:1067 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000236327 
Target:MDP0000076511 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGUUGUUUGGACAUGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000076511 
Target:MDP0000187512 
Target Start:1537 
Target End:1556 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AACUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000187512 
Target:MDP0000229637 
Target Start:1726 
Target End:1745 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AAUUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000229637 
Target:MDP0000868785 
Target Start:2719 
Target End:2738 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGCUGUUUGGAUGAGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000868785 
Target:MDP0000161046 
Target Start:539 
Target End:559 
miRNA Aligned Fragment:5'-UCGCUUGGUGCAGGUCGGGAA-3' 
Target Aligned Fragment:3'- AGCGAACCACGUCCAGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000161046 
Target:MDP0000321714 
Target Start:356 
Target End:376 
miRNA Aligned Fragment:5'-UCGCUUGGUGCAGGUCGGGAA-3' 
Target Aligned Fragment:3'- GGCGGACCAUGUUCAGUCUUU -5' 
Inhibition Type:Cleavage 
MDP0000321714 
Target:MDP0000372473 
Target Start:651 
Target End:671 
miRNA Aligned Fragment:5'-UCGCUUGGUGCAGGUCGGGAA-3' 
Target Aligned Fragment:3'- AGUGAAUCACGUCAAGCCUUU -5' 
Inhibition Type:Cleavage 
MDP0000372473 
Target:MDP0000229527 
Target Start:4713 
Target End:4733 
miRNA Aligned Fragment:5'-UCGCUUGGUGCAGGUCGGGAA-3' 
Target Aligned Fragment:3'- AGUGAAUCACGUCAAGCCUUU -5' 
Inhibition Type:Cleavage 
MDP0000229527 
Target:MDP0000230907 
Target Start:4992 
Target End:5012 
miRNA Aligned Fragment:5'-UCGCUUGGUGCAGGUCGGGAA-3' 
Target Aligned Fragment:3'- AGUGAAUCACGUCAAGCCUUU -5' 
Inhibition Type:Cleavage 
MDP0000230907 
Target:MDP0000298208 
Target Start:584 
Target End:604 
miRNA Aligned Fragment:5'-UCGCUUGGUGCAGGUCGGGAA-3' 
Target Aligned Fragment:3'- AGCGAACCAUGUUCAGGUUUU -5' 
Inhibition Type:Cleavage 
MDP0000298208 
Target:MDP0000900762 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
MDP0000900762 
Target:MDP0000278249 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000278249 
Target:MDP0000508371 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000508371 
Target:MDP0000717558 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000717558 
Target:MDP0000200335 
Target Start:420 
Target End:439 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
MDP0000200335 
Target:MDP0000248808 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
MDP0000248808 
Target:MDP0000263766 
Target Start:955 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1027 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1027 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1075 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000146640 
Target Start:1078 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1078 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000246046 
Target Start:1021 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000322647 
Target Start:1006 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:991 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:781 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000170630 
Target Start:769 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUGU -5' 
Inhibition Type:Translation 
MDP0000170630 
Target:MDP0000130479 
Target Start:1720 
Target End:1739 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCUGUCUUCUUUAUUUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000130479 
Target:MDP0000325736 
Target Start:38 
Target End:59 
miRNA Aligned Fragment:5'-UGACAGAAG-AGAGAGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCGUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
MDP0000325736 
Target:MDP0000076511 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGUUGUUUGGACAUGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000076511 
Target:MDP0000187512 
Target Start:1537 
Target End:1556 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AACUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000187512 
Target:MDP0000229637 
Target Start:1726 
Target End:1745 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AAUUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000229637 
Target:MDP0000868785 
Target Start:2719 
Target End:2738 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGCUGUUUGGAUGAGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000868785 
Target:MDP0000184536 
Target Start:248 
Target End:267 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGUAACAGACAAGCUGGA -5' 
Inhibition Type:Cleavage 
MDP0000184536 
Target:MDP0000124555 
Target Start:336 
Target End:355 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAAUAGACAAGCUGGG -5' 
Inhibition Type:Cleavage 
MDP0000124555 
Target:MDP0000242368 
Target Start:1046 
Target End:1066 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCUU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAGUCUGGAA -5' 
Inhibition Type:Cleavage 
MDP0000242368 
Target:MDP0000581761 
Target Start:117 
Target End:136 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGUAACAGACAAGCUGGC -5' 
Inhibition Type:Cleavage 
MDP0000581761 
Target:MDP0000261265 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
MDP0000261265 
Target:MDP0000144808 
Target Start:297 
Target End:316 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
MDP0000144808 
Target:MDP0000153280 
Target Start:297 
Target End:316 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
MDP0000153280 
Target:MDP0000931057 
Target Start:336 
Target End:355 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
MDP0000931057 
Target:MDP0000317209 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAAUAGACAAGCUGGU -5' 
Inhibition Type:Cleavage 
MDP0000317209 
Target:MDP0000475808 
Target Start:201 
Target End:220 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAAGCUGGC -5' 
Inhibition Type:Cleavage 
MDP0000475808 
Target:MDP0000226215 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
MDP0000226215 
Target:MDP0000253904 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
MDP0000253904 
Target:MDP0000143276 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
MDP0000143276 
Target:MDP0000133817 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
MDP0000133817 
Target:MDP0000318013 
Target Start:234 
Target End:253 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
MDP0000318013 
Target:MDP0000184538 
Target Start:300 
Target End:319 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCAGGA -5' 
Inhibition Type:Cleavage 
MDP0000184538 
Target:MDP0000157940 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AGAGCAACAGUCAAGCUGGA -5' 
Inhibition Type:Translation 
MDP0000157940 
Target:MDP0000887107 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCGGGA -5' 
Inhibition Type:Cleavage 
MDP0000887107 
Target:MDP0000140609 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCGGGA -5' 
Inhibition Type:Cleavage 
MDP0000140609 
Target:MDP0000437717 
Target Start:294 
Target End:313 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCCGGA -5' 
Inhibition Type:Cleavage 
MDP0000437717 
Target:MDP0000228252 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAGGCUGGC -5' 
Inhibition Type:Cleavage 
MDP0000228252 
Target:MDP0000320772 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAGGCUGGC -5' 
Inhibition Type:Cleavage 
MDP0000320772 
Target:MDP0000302984 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGGCAGGCUGGC -5' 
Inhibition Type:Cleavage 
MDP0000302984 
Target:MDP0000289768 
Target Start:225 
Target End:244 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGCAACAGACAGGMCGGA -5' 
Inhibition Type:Cleavage 
MDP0000289768 
Target:MDP0000031172 
Target Start:291 
Target End:310 
miRNA Aligned Fragment:5'-UUUCGUUGUCUGUUCGACCU-3' 
Target Aligned Fragment:3'- AAAGUAACAGACAAGCGGGG -5' 
Inhibition Type:Cleavage 
MDP0000031172 
Target:MDP0000578193 
Target Start:310 
Target End:331 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000578193 
Target:MDP0000145557 
Target Start:2341 
Target End:2362 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000145557 
Target:MDP0000650225 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000650225 
Target:MDP0000143276 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000143276 
Target:MDP0000133817 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000133817 
Target:MDP0000164048 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCGCAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000164048 
Target:MDP0000124555 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000124555 
Target:MDP0000193637 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000193637 
Target:MDP0000642761 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000642761 
Target:MDP0000261265 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUCAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000261265 
Target:MDP0000253904 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000253904 
Target:MDP0000226215 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000226215 
Target:MDP0000931057 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000931057 
Target:MDP0000167314 
Target Start:343 
Target End:364 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000167314 
Target:MDP0000264051 
Target Start:340 
Target End:361 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000264051 
Target:MDP0000581761 
Target Start:148 
Target End:169 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGGACGACUCUACUCAUAAGGU -5' 
Inhibition Type:Translation 
MDP0000581761 
Target:MDP0000268980 
Target Start:973 
Target End:994 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGGACGAGUUCACUCUUAAGGU -5' 
Inhibition Type:Translation 
MDP0000268980 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000171877 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000146640 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000778465 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000246046 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000297978 
Target:MDP0000170630 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000176265 
Target:MDP0000325736 
Target Start:39 
Target End:59 
miRNA Aligned Fragment:5'-UGACAGAAG-AUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCGUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000325736 
Target:MDP0000399057 
Target Start:1625 
Target End:1644 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCGGUCUUUUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000399057 
Target:MDP0000277391 
Target Start:1472 
Target End:1491 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCGGUCUUUUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000277391 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Translation 
MDP0000589558 
Target:MDP0000213066 
Target Start:10406 
Target End:10425 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
MDP0000213066 
Target:MDP0000266073 
Target Start:2013 
Target End:2032 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
MDP0000266073 
Target:MDP0000261112 
Target Start:312 
Target End:332 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000261112 
Target:MDP0000243533 
Target Start:348 
Target End:368 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000243533 
Target:MDP0000808163 
Target Start:546 
Target End:566 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000808163 
Target:MDP0000274400 
Target Start:351 
Target End:371 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000274400 
Target:MDP0000322576 
Target Start:600 
Target End:620 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000322576 
Target:MDP0000842815 
Target Start:654 
Target End:674 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000842815 
Target:MDP0000214734 
Target Start:558 
Target End:578 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGYGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000214734 
Target:MDP0000125282 
Target Start:774 
Target End:794 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
MDP0000125282 
Target:MDP0000215583 
Target Start:753 
Target End:773 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
MDP0000215583 
Target:MDP0000276970 
Target Start:372 
Target End:392 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUUCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
MDP0000276970 
Target:MDP0000814056 
Target Start:630 
Target End:650 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUACGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000814056 
Target:MDP0000204597 
Target Start:487 
Target End:506 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- AGGUGUACGAAAGAACUUGC -5' 
Inhibition Type:Cleavage 
MDP0000204597 
Target:MDP0000292682 
Target Start:959 
Target End:978 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- AGGUGUUCGAAGGAGUUUGC -5' 
Inhibition Type:Cleavage 
MDP0000292682 
Target:MDP0000184906 
Target Start:1204 
Target End:1223 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- GGGUGUUUGAAAGAACUUGG -5' 
Inhibition Type:Cleavage 
MDP0000184906 
Target:MDP0000416307 
Target Start:121 
Target End:141 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGGAACAACUUACC -5' 
Inhibition Type:Cleavage 
MDP0000416307 
Target:MDP0000649405 
Target Start:60 
Target End:81 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGAUC-3' 
Target Aligned Fragment:3'- ACCUCCGUUGCCAAGUAACUCG -5' 
Inhibition Type:Cleavage 
MDP0000649405 
Target:MDP0000816713 
Target Start:851 
Target End:870 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGA-3' 
Target Aligned Fragment:3'- AUCUCUGUCGUCAAGUAGUU -5' 
Inhibition Type:Cleavage 
MDP0000816713 
Target:MDP0000214155 
Target Start:560 
Target End:579 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGA-3' 
Target Aligned Fragment:3'- ACUUCCGUCGCCGAGUAGAA -5' 
Inhibition Type:Cleavage 
MDP0000214155 
Target:MDP0000122582 
Target Start:925 
Target End:945 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- ACCUCCGACGACAAGUAGUUG -5' 
Inhibition Type:Translation 
MDP0000122582 
Target:MDP0000315352 
Target Start:1030 
Target End:1050 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- ACCUCCGACGACAAGUAGUUG -5' 
Inhibition Type:Translation 
MDP0000315352 
Target:MDP0000251484 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000005879 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000005879 
Target:MDP0000242861 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2698 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGGUG -5' 
Inhibition Type:Translation 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000284115 
Target Start:151 
Target End:170 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACAGUA -5' 
Inhibition Type:Cleavage 
MDP0000284115 
Target:MDP0000291818 
Target Start:1789 
Target End:1808 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACAGUA -5' 
Inhibition Type:Cleavage 
MDP0000291818 
Target:MDP0000545249 
Target Start:460 
Target End:480 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
MDP0000545249 
Target:MDP0000256280 
Target Start:970 
Target End:990 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
MDP0000256280 
Target:MDP0000276665 
Target Start:916 
Target End:936 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
MDP0000276665 
Target:MDP0000922352 
Target Start:347 
Target End:366 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGGUAUACGAGGACAGUA -5' 
Inhibition Type:Cleavage 
MDP0000922352 
Target:MDP0000301405 
Target Start:1792 
Target End:1811 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACGGUA -5' 
Inhibition Type:Cleavage 
MDP0000301405 
Target:MDP0000154590 
Target Start:2802 
Target End:2821 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAAGACGGUU -5' 
Inhibition Type:Cleavage 
MDP0000154590 
Target:MDP0000553601 
Target Start:3088 
Target End:3107 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAAGACGGUU -5' 
Inhibition Type:Cleavage 
MDP0000553601 
Target:MDP0000877582 
Target Start:408 
Target End:427 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAUACGAAGACUUUA -5' 
Inhibition Type:Cleavage 
MDP0000877582 
Target:MDP0000272991 
Target Start:17 
Target End:36 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- UGAGAGAUAGGGAGACAGUG -5' 
Inhibition Type:Translation 
MDP0000272991 
Target:MDP0000177665 
Target Start:414 
Target End:433 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAUACGAAGACUUUA -5' 
Inhibition Type:Cleavage 
MDP0000177665 
Target:MDP0000207352 
Target Start:1360 
Target End:1379 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGGGAGAGGUGAAGACAGUG -5' 
Inhibition Type:Cleavage 
MDP0000207352 
Target:MDP0000273608 
Target Start:124 
Target End:144 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAUGAGAGUAG -5' 
Inhibition Type:Cleavage 
MDP0000273608 
Target:MDP0000649405 
Target Start:60 
Target End:80 
miRNA Aligned Fragment:5'-GGAGGCAGCGGUUCAUCGAUC-3' 
Target Aligned Fragment:3'- CCUCCGUUGCCAAGUAACUCG -5' 
Inhibition Type:Cleavage 
MDP0000649405 
Target:MDP0000816713 
Target Start:850 
Target End:869 
miRNA Aligned Fragment:5'-GGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- UCUCUGUCGUCAAGUAGUUU -5' 
Inhibition Type:Cleavage 
MDP0000816713 
Target:MDP0000283138 
Target Start:4137 
Target End:4156 
miRNA Aligned Fragment:5'-CCCGCCUUGCAUCAACUGAA-3' 
Target Aligned Fragment:3'- GGGCGAAACGUGGUUGACUU -5' 
Inhibition Type:Cleavage 
MDP0000283138 
Target:MDP0000686666 
Target Start:267 
Target End:286 
miRNA Aligned Fragment:5'-CCCGCCUUGCAUCAACUGAA-3' 
Target Aligned Fragment:3'- GGACGGAACGUAGUUAACUU -5' 
Inhibition Type:Cleavage 
MDP0000686666 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000170630 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Translation 
MDP0000170630 
Target:MDP0000130479 
Target Start:1720 
Target End:1739 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCUGUCUUCUUUAUUUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000130479 
Target:MDP0000128688 
Target Start:2316 
Target End:2335 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUUUCUUUUUUCUG -5' 
Inhibition Type:Cleavage 
MDP0000128688 
Target:MDP0000142582 
Target Start:780 
Target End:799 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000263766 
Target Start:954 
Target End:973 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000263766 
Target:MDP0000119458 
Target Start:1026 
Target End:1045 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000119458 
Target:MDP0000193702 
Target Start:1026 
Target End:1045 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000193702 
Target:MDP0000171877 
Target Start:1074 
Target End:1093 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000171877 
Target:MDP0000146640 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000146640 
Target:MDP0000778465 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000778465 
Target:MDP0000246046 
Target Start:1020 
Target End:1039 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000246046 
Target:MDP0000322647 
Target Start:1005 
Target End:1024 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000322647 
Target:MDP0000170630 
Target Start:768 
Target End:787 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUAUCUCCCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000252393 
Target Start:1577 
Target End:1596 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- CGUCUUCUYUCUUUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000252393 
Target:MDP0000399057 
Target Start:1623 
Target End:1642 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- GGUCUUUUAUCUCUCGUGGC -5' 
Inhibition Type:Cleavage 
MDP0000399057 
Target:MDP0000277391 
Target Start:1470 
Target End:1489 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- GGUCUUUUAUCUCUCGUGGC -5' 
Inhibition Type:Cleavage 
MDP0000277391 
Target:MDP0000589558 
Target Start:990 
Target End:1009 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCGCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000589558 
Target:MDP0000297978 
Target Start:792 
Target End:811 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCC -5' 
Inhibition Type:Translation 
MDP0000297978 
Target:MDP0000232031 
Target Start:262 
Target End:281 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUGUUUUUGGUGUC -5' 
Inhibition Type:Cleavage 
MDP0000232031 
Target:MDP0000131279 
Target Start:262 
Target End:281 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUGUUUUUGGUGUC -5' 
Inhibition Type:Cleavage 
MDP0000131279 
Target:MDP0000249364 
Target Start:2712 
Target End:2731 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCU -5' 
Inhibition Type:Translation 
MDP0000249364 
Target:MDP0000155354 
Target Start:1134 
Target End:1153 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCU -5' 
Inhibition Type:Translation 
MDP0000155354 
Target:MDP0000262141 
Target Start:843 
Target End:862 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCA -5' 
Inhibition Type:Translation 
MDP0000262141 
Target:MDP0000325736 
Target Start:37 
Target End:57 
miRNA Aligned Fragment:5'-ACAGAAG-AUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCGUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000325736 
Target:MDP0000311497 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUUUAACUCUCGUUUC -5' 
Inhibition Type:Translation 
MDP0000311497 
Target:MDP0000757833 
Target Start:44 
Target End:63 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- ACCUUGACUUCCUUUGAGGA -5' 
Inhibition Type:Cleavage 
MDP0000757833 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000237553 
Target Start:298 
Target End:317 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000237553 
Target:MDP0000442611 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000287069 
Target Start:1180 
Target End:1199 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000287069 
Target:MDP0000763497 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000763497 
Target:MDP0000920127 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000920127 
Target:MDP0000927314 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000927314 
Target:MDP0000168665 
Target Start:2649 
Target End:2668 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AGCCUGGCUUACCUUGGGGA -5' 
Inhibition Type:Translation 
MDP0000168665 
Target:MDP0000194772 
Target Start:313 
Target End:332 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUA -5' 
Inhibition Type:Translation 
MDP0000194772 
Target:MDP0000189746 
Target Start:1226 
Target End:1245 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGGUUUCCCACAAGGA -5' 
Inhibition Type:Cleavage 
MDP0000189746 
Target:MDP0000243495 
Target Start:1540 
Target End:1559 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCCAGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000243495 
Target:MDP0000214352 
Target Start:1517 
Target End:1537 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- GAACCCCACUUCCUUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000214352 
Target:MDP0000138860 
Target Start:1589 
Target End:1609 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- GAACCCCACUUCCUUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000138860 
Target:MDP0000211225 
Target Start:2211 
Target End:2231 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACCUCACUUACUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000211225 
Target:MDP0000271448 
Target Start:1104 
Target End:1123 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- UAGCCUCGUUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000271448 
Target:MDP0000252305 
Target Start:398 
Target End:418 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000252305 
Target:MDP0000295160 
Target Start:404 
Target End:424 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000295160 
Target:MDP0000284209 
Target Start:623 
Target End:643 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000284209 
Target:MDP0000121883 
Target Start:1175 
Target End:1194 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACACAACAAAGAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000121883 
Target:MDP0000272633 
Target Start:59 
Target End:78 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCAAAAAGUAAAA -5' 
Inhibition Type:Cleavage 
MDP0000272633 
Target:MDP0000584547 
Target Start:1733 
Target End:1752 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACGCAACAAAAAACAAAC -5' 
Inhibition Type:Cleavage 
MDP0000584547 
Target:MDP0000221576 
Target Start:1913 
Target End:1932 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACGCAACAAAAAAGAAAA -5' 
Inhibition Type:Cleavage 
MDP0000221576 
Target:MDP0000144996 
Target Start:2555 
Target End:2574 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACGCAACAAAAAAGAAAA -5' 
Inhibition Type:Cleavage 
MDP0000144996 
Target:MDP0000140336 
Target Start:738 
Target End:757 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACGACAAGAAGCAAAC -5' 
Inhibition Type:Cleavage 
MDP0000140336 
Target:MDP0000161311 
Target Start:98 
Target End:117 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACAAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000161311 
Target:MDP0000358759 
Target Start:536 
Target End:555 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACAUAACGAAAAAUAAAG -5' 
Inhibition Type:Cleavage 
MDP0000358759 
Target:MDP0000607252 
Target Start:327 
Target End:346 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AGACAAAACAAAAAACGAAA -5' 
Inhibition Type:Cleavage 
MDP0000607252 
Target:MDP0000568244 
Target Start:514 
Target End:533 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000568244 
Target:MDP0000225718 
Target Start:869 
Target End:888 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACACAACGAAGAAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000225718 
Target:MDP0000920266 
Target Start:1033 
Target End:1052 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000920266 
Target:MDP0000739959 
Target Start:599 
Target End:618 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAGAAUCAAA -5' 
Inhibition Type:Cleavage 
MDP0000739959 
Target:MDP0000459146 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000459146 
Target:MDP0000131142 
Target Start:1324 
Target End:1343 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000131142 
Target:MDP0000300139 
Target Start:908 
Target End:927 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCGAAAGGUAAAA -5' 
Inhibition Type:Cleavage 
MDP0000300139 
Target:MDP0000130320 
Target Start:866 
Target End:885 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCGAAAGGUAAAA -5' 
Inhibition Type:Cleavage 
MDP0000130320 
Target:MDP0000213799 
Target Start:2389 
Target End:2408 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACAUAAGAAAAAGCAAAA -5' 
Inhibition Type:Translation 
MDP0000213799 
Target:MDP0000703418 
Target Start:16 
Target End:35 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAAUACGACGGGAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000703418 
Target:MDP0000297746 
Target Start:394 
Target End:413 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAAGGCUAAA -5' 
Inhibition Type:Cleavage 
MDP0000297746 
Target:MDP0000350586 
Target Start:181 
Target End:200 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACGAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000350586 
Target:MDP0000144055 
Target Start:471 
Target End:490 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACACUACAAAAAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000144055 
Target:MDP0000347536 
Target Start:68 
Target End:87 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AACCAAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000347536 
Target:MDP0000347699 
Target Start:39 
Target End:58 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACAAAAUAAAAGACAGAA -5' 
Inhibition Type:Cleavage 
MDP0000347699 
Target:MDP0000206902 
Target Start:189 
Target End:208 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAGCACGGCGAAGAACGAAA -5' 
Inhibition Type:Cleavage 
MDP0000206902 
Target:MDP0000238967 
Target Start:1833 
Target End:1853 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UUUUACAACGGACCGAACUCC -5' 
Inhibition Type:Cleavage 
MDP0000238967 
Target:MDP0000279466 
Target Start:51 
Target End:71 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UCUUACAGCAGGCUGGGCUUU -5' 
Inhibition Type:Cleavage 
MDP0000279466 
Target:MDP0000453068 
Target Start:51 
Target End:71 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UCUUACAGCAGGCUGGGCUUU -5' 
Inhibition Type:Cleavage 
MDP0000453068 
Target:MDP0000307668 
Target Start:1752 
Target End:1772 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UUUUACAACGGGCCGAACUCC -5' 
Inhibition Type:Cleavage 
MDP0000307668 
Target:MDP0000292188 
Target Start:1752 
Target End:1772 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UUUUACAACGGGCCGAACUCC -5' 
Inhibition Type:Cleavage 
MDP0000292188 
Target:MDP0000161712 
Target Start:895 
Target End:914 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- UUUUAUGGCAGACCGAGUUC -5' 
Inhibition Type:Cleavage 
MDP0000161712 
Target:MDP0000247776 
Target Start:1012 
Target End:1031 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- UUUUAUGGCAGACCGAGUUC -5' 
Inhibition Type:Cleavage 
MDP0000247776 
Target:MDP0000280476 
Target Start:1743 
Target End:1763 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UCUUACAAAGGACCGAACUCC -5' 
Inhibition Type:Translation 
MDP0000280476 
Target:MDP0000288921 
Target Start:423 
Target End:442 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- CUUUACAACCGGUUGAGCUC -5' 
Inhibition Type:Translation 
MDP0000288921 
Target:MDP0000271818 
Target Start:423 
Target End:442 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- CUUUACAACCGGUUGAGCUC -5' 
Inhibition Type:Translation 
MDP0000271818 
Target:MDP0000278349 
Target Start:954 
Target End:973 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AGUCUUGAGACAGGUGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000278349 
Target:MDP0000268873 
Target Start:1198 
Target End:1217 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- CAUCGUGAGACAGGUGGAAG -5' 
Inhibition Type:Cleavage 
MDP0000268873 
Target:MDP0000209024 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AAUCUUAAGACAGGAGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000209024 
Target:MDP0000853426 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AAUCUUAAGACAGGAGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000853426 
Target:MDP0000278177 
Target Start:438 
Target End:457 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- GGCCGUAAGGCGGGUGGAAG -5' 
Inhibition Type:Cleavage 
MDP0000278177 
Target:MDP0000275896 
Target Start:3 
Target End:22 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AACCGUAACGCAGGAGGAGG -5' 
Inhibition Type:Translation 
MDP0000275896 
Target:MDP0000290546 
Target Start:27 
Target End:47 
miRNA Aligned Fragment:5'-UUGGCAUUC-UGUCCACCUCC-3' 
Target Aligned Fragment:3'- AACCGUAAGAACAGGUGGACG -5' 
Inhibition Type:Translation 
MDP0000290546 
Target:MDP0000501816 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000501816 
Target:MDP0000193012 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000193012 
Target:MDP0000160829 
Target Start:1288 
Target End:1308 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
MDP0000160829 
Target:MDP0000553830 
Target Start:1285 
Target End:1305 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
MDP0000553830 
Target:MDP0000279176 
Target Start:2743 
Target End:2763 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGCGGAAAGGAGUUGAC -5' 
Inhibition Type:Cleavage 
MDP0000279176 
Target:MDP0000261112 
Target Start:312 
Target End:333 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000261112 
Target:MDP0000243533 
Target Start:348 
Target End:369 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000243533 
Target:MDP0000808163 
Target Start:546 
Target End:567 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000808163 
Target:MDP0000274400 
Target Start:351 
Target End:372 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000274400 
Target:MDP0000322576 
Target Start:600 
Target End:621 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000322576 
Target:MDP0000677637 
Target Start:2234 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGA -5' 
Inhibition Type:Cleavage 
MDP0000677637 
Target:MDP0000125282 
Target Start:776 
Target End:795 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000125282 
Target:MDP0000215583 
Target Start:755 
Target End:774 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000215583 
Target:MDP0000320460 
Target Start:572 
Target End:591 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AAGGUGCUYGAAGAACUCGA -5' 
Inhibition Type:Translation 
MDP0000320460 
Target:MDP0000127332 
Target Start:3086 
Target End:3105 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GGGGUGCCGAAAGAGUUCGA -5' 
Inhibition Type:Cleavage 
MDP0000127332 
Target:MDP0000212849 
Target Start:3086 
Target End:3105 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GGGGUGCCGAAAGAGUUCGA -5' 
Inhibition Type:Cleavage 
MDP0000212849 
Target:MDP0000146933 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCG-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000146933 
Target:MDP0000296077 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCG-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000296077 
Target:MDP0000314593 
Target Start:666 
Target End:686 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
MDP0000314593 
Target:MDP0000375005 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-CAGCCAAGGAUGACUUGCCG-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000375005 
Target:MDP0000183865 
Target Start:437 
Target End:457 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000183865 
Target:MDP0000164531 
Target Start:914 
Target End:934 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000164531 
Target:MDP0000279028 
Target Start:962 
Target End:982 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000279028 
Target:MDP0000314593 
Target Start:666 
Target End:686 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
MDP0000314593 
Target:MDP0000885534 
Target Start:849 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
MDP0000885534 
Target:MDP0000263881 
Target Start:1620 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
MDP0000263881 
Target:MDP0000375005 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000375005 
Target:MDP0000146933 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000146933 
Target:MDP0000296077 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000296077 
Target:MDP0000778477 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000778477 
Target:MDP0000784909 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000784909 
Target Start:1227 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1356 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1380 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1908 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000671120 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUGGUUCGGCACGGUUUUA -5' 
Inhibition Type:Cleavage 
MDP0000671120 
Target:MDP0000137127 
Target Start:447 
Target End:466 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUGGUUCGGCACGGUUUUA -5' 
Inhibition Type:Cleavage 
MDP0000137127 
Target:MDP0000547757 
Target Start:948 
Target End:967 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAAUUUGGCACGGUUUUG -5' 
Inhibition Type:Cleavage 
MDP0000547757 
Target:MDP0000651634 
Target Start:661 
Target End:680 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCCAUACGGUUGUA -5' 
Inhibition Type:Translation 
MDP0000651634 
Target:MDP0000302855 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
MDP0000302855 
Target:MDP0000119499 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUUCGUACGUUUAUA -5' 
Inhibition Type:Translation 
MDP0000119499 
Target:MDP0000233292 
Target Start:2314 
Target End:2333 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUUCGUACGCUUAUA -5' 
Inhibition Type:Translation 
MDP0000233292 
Target:MDP0000291986 
Target Start:2184 
Target End:2203 
miRNA Aligned Fragment:5'-UGAUUGAGCCGUGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUUCGUACGUUUAUA -5' 
Inhibition Type:Translation 
MDP0000291986 
Target:MDP0000784909 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000750392 
Target Start:1764 
Target End:1784 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCCA-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
MDP0000750392 
Target:MDP0000256621 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000256621 
Target:MDP0000232116 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000232116 
Target:MDP0000273491 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000273491 
Target:MDP0000221322 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000221322 
Target:MDP0000131481 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000131481 
Target:MDP0000120635 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000167989 
Target Start:59 
Target End:79 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCCA-3' 
Target Aligned Fragment:3'- CCGGAUCGAGGGAUGAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000167989 
Target:MDP0000776180 
Target Start:154 
Target End:173 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGGCCGAAGGAGGUACGG -5' 
Inhibition Type:Translation 
MDP0000776180 
Target:MDP0000528658 
Target Start:527 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000528658 
Target:MDP0000298182 
Target Start:617 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000298182 
Target:MDP0000310981 
Target Start:797 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACGA -5' 
Inhibition Type:Cleavage 
MDP0000310981 
Target:MDP0000271887 
Target Start:94 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000271887 
Target:MDP0000911724 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000911724 
Target:MDP0000121265 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000121265 
Target:MDP0000231813 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUCUACU -5' 
Inhibition Type:Cleavage 
MDP0000231813 
Target:MDP0000289153 
Target Start:76 
Target End:96 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCCUGUGUGG -5' 
Inhibition Type:Cleavage 
MDP0000289153 
Target:MDP0000166902 
Target Start:7 
Target End:27 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGA -5' 
Inhibition Type:Cleavage 
MDP0000166902 
Target:MDP0000481317 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
MDP0000481317 
Target:MDP0000384344 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
MDP0000384344 
Target:MDP0000198995 
Target Start:264 
Target End:283 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
MDP0000198995 
Target:MDP0000750318 
Target Start:16 
Target End:36 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGG -5' 
Inhibition Type:Cleavage 
MDP0000750318 
Target:MDP0000135060 
Target Start:379 
Target End:399 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGG -5' 
Inhibition Type:Cleavage 
MDP0000135060 
Target:MDP0000269941 
Target Start:25 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUUCACG -5' 
Inhibition Type:Cleavage 
MDP0000269941 
Target:MDP0000784909 
Target Start:1227 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1356 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1380 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1908 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000395022 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAU-3' 
Target Aligned Fragment:3'- ACCAAUUCGGUGCAGUUGUA -5' 
Inhibition Type:Cleavage 
MDP0000395022 
Target:MDP0000302855 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGUCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
MDP0000302855 
Target:MDP0000155674 
Target Start:2039 
Target End:2059 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUAUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000155674 
Target:MDP0000323007 
Target Start:14 
Target End:34 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGUGURUGU -5' 
Inhibition Type:Cleavage 
MDP0000323007 
Target:MDP0000333896 
Target Start:115 
Target End:135 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000333896 
Target:MDP0000267175 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUAUCUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000267175 
Target:MDP0000454891 
Target Start:1137 
Target End:1157 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
MDP0000454891 
Target:MDP0000490509 
Target Start:1146 
Target End:1166 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
MDP0000490509 
Target:MDP0000226096 
Target Start:937 
Target End:956 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- AGUAUGUAUGUGUGUAUGUU -5' 
Inhibition Type:Cleavage 
MDP0000226096 
Target:MDP0000356405 
Target Start:90 
Target End:110 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUAUAUAUGUGUAUGUGU -5' 
Inhibition Type:Translation 
MDP0000356405 
Target:MDP0000357060 
Target Start:89 
Target End:110 
miRNA Aligned Fragment:5'-AUAUACAUAC-ACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUUGUGUAUGUGU -5' 
Inhibition Type:Translation 
MDP0000357060 
Target:MDP0000305012 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUGUAUGUGGGUGUGUA -5' 
Inhibition Type:Cleavage 
MDP0000305012 
Target:MDP0000224017 
Target Start:707 
Target End:727 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUAUGUGUUUGGGUGU -5' 
Inhibition Type:Cleavage 
MDP0000224017 
Target:MDP0000193534 
Target Start:391 
Target End:410 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUGUAUGUGUGUCUCUC -5' 
Inhibition Type:Cleavage 
MDP0000193534 
Target:MDP0000183865 
Target Start:437 
Target End:457 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000183865 
Target:MDP0000164531 
Target Start:914 
Target End:934 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000164531 
Target:MDP0000279028 
Target Start:962 
Target End:982 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000279028 
Target:MDP0000885534 
Target Start:847 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUGC-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGAAG -5' 
Inhibition Type:Translation 
MDP0000885534 
Target:MDP0000263881 
Target Start:1618 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUGC-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGAAG -5' 
Inhibition Type:Translation 
MDP0000263881 
Target:MDP0000314593 
Target Start:666 
Target End:686 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
MDP0000314593 
Target:MDP0000375005 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000375005 
Target:MDP0000146933 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000146933 
Target:MDP0000296077 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000296077 
Target:MDP0000778477 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000778477 
Target:MDP0000784909 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000263189 
Target Start:1243 
Target End:1263 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUCC-3' 
Target Aligned Fragment:3'- GGCUCGGAGGAGUUAUAGAGG -5' 
Inhibition Type:Translation 
MDP0000263189 
Target:MDP0000222713 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
MDP0000222713 
Target:MDP0000221331 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
MDP0000221331 
Target:MDP0000221212 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
MDP0000221212 
Target:MDP0000200821 
Target Start:52 
Target End:71 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUAGGUGCAGUUUUAGAG -5' 
Inhibition Type:Cleavage 
MDP0000200821 
Target:MDP0000297773 
Target Start:292 
Target End:311 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AAUUCGGUUCAGGUAUAGAG -5' 
Inhibition Type:Translation 
MDP0000297773 
Target:MDP0000302554 
Target Start:1578 
Target End:1597 
miRNA Aligned Fragment:5'-UUGAGCCGCGUCAAUAUCUC-3' 
Target Aligned Fragment:3'- AACUUGGUUCAUUUAUAGAG -5' 
Inhibition Type:Translation 
MDP0000302554 
Target:MDP0000314593 
Target Start:666 
Target End:685 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
MDP0000314593 
Target:MDP0000375005 
Target Start:874 
Target End:893 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCCUACUUAACGGUA -5' 
Inhibition Type:Cleavage 
MDP0000375005 
Target:MDP0000146933 
Target Start:1358 
Target End:1377 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUUAACGGCG -5' 
Inhibition Type:Cleavage 
MDP0000146933 
Target:MDP0000296077 
Target Start:1631 
Target End:1650 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUUAACGGCG -5' 
Inhibition Type:Cleavage 
MDP0000296077 
Target:MDP0000183865 
Target Start:437 
Target End:456 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000183865 
Target:MDP0000309396 
Target Start:688 
Target End:707 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UUGGUUUCUACUGAAGGGUU -5' 
Inhibition Type:Cleavage 
MDP0000309396 
Target:MDP0000313089 
Target Start:368 
Target End:387 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UUGGUUUCUACUGAAGGGUU -5' 
Inhibition Type:Cleavage 
MDP0000313089 
Target:MDP0000164531 
Target Start:914 
Target End:933 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000164531 
Target:MDP0000279028 
Target Start:962 
Target End:981 
miRNA Aligned Fragment:5'-AGCCAAGGAUGACUUGCCGG-3' 
Target Aligned Fragment:3'- UCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000279028 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000320690 
Target Start:2635 
Target End:2654 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACCGUCUUCUCUCUCUCCUA -5' 
Inhibition Type:Cleavage 
MDP0000320690 
Target:MDP0000286390 
Target Start:364 
Target End:383 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- AUCGUCUUCUGUCUCUCGUA -5' 
Inhibition Type:Translation 
MDP0000286390 
Target:MDP0000170630 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Translation 
MDP0000170630 
Target:MDP0000142582 
Target Start:777 
Target End:797 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACCC-3' 
Target Aligned Fragment:3'- UCUUCUAUCUCUCGUGUUGGG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000146640 
Target Start:1075 
Target End:1094 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1075 
Target End:1094 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000263766 
Target Start:951 
Target End:971 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACCC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCAGG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000171877 
Target Start:1071 
Target End:1091 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACCC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1017 
Target End:1037 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACCC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000119458 
Target Start:1024 
Target End:1043 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGA -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1024 
Target End:1043 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGA -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000322647 
Target Start:1003 
Target End:1022 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGUCGA -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000161521 
Target Start:36 
Target End:55 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUCUUGU -5' 
Inhibition Type:Cleavage 
MDP0000161521 
Target:MDP0000120398 
Target Start:36 
Target End:55 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUCUUGU -5' 
Inhibition Type:Cleavage 
MDP0000120398 
Target:MDP0000268951 
Target Start:1272 
Target End:1291 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUAGUCUCUCUCGUGUUGG -5' 
Inhibition Type:Cleavage 
MDP0000268951 
Target:MDP0000589558 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCGCUCGUGUCGG -5' 
Inhibition Type:Translation 
MDP0000589558 
Target:MDP0000262141 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCAGG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000249364 
Target Start:2710 
Target End:2729 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCUAC -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000252393 
Target Start:1574 
Target End:1594 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACCC-3' 
Target Aligned Fragment:3'- UCUUCUYUCUUUCGUGUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000252393 
Target:MDP0000155354 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCUAC -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000176265 
Target Start:700 
Target End:719 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUCUCUCUCGUGCUAA -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000916313 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUUUUUCUGGUGUUGU -5' 
Inhibition Type:Cleavage 
MDP0000916313 
Target:MDP0000214537 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAGAGAGAGAGCACAACC-3' 
Target Aligned Fragment:3'- UCUUCUUUUUCUGGUGUUGU -5' 
Inhibition Type:Cleavage 
MDP0000214537 
Target:MDP0000249364 
Target Start:2714 
Target End:2734 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000155354 
Target Start:1136 
Target End:1156 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000322647 
Target Start:1007 
Target End:1027 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000297978 
Target Start:794 
Target End:814 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000119458 
Target Start:1028 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1028 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1096 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1022 
Target End:1042 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000263766 
Target Start:956 
Target End:976 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000146640 
Target Start:1079 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1079 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000262141 
Target Start:845 
Target End:865 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000176265 
Target Start:704 
Target End:724 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:992 
Target End:1012 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:782 
Target End:802 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000161521 
Target Start:41 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGU -5' 
Inhibition Type:Cleavage 
MDP0000161521 
Target:MDP0000120398 
Target Start:41 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGU -5' 
Inhibition Type:Cleavage 
MDP0000120398 
Target:MDP0000170630 
Target Start:770 
Target End:790 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000717179 
Target Start:231 
Target End:251 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUACUCUUUUUGGUG -5' 
Inhibition Type:Translation 
MDP0000717179 
Target:MDP0000209716 
Target Start:564 
Target End:584 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000209716 
Target:MDP0000322647 
Target Start:1006 
Target End:1027 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000119458 
Target Start:1027 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1027 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1075 
Target End:1096 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1021 
Target End:1042 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000249364 
Target Start:2714 
Target End:2734 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:955 
Target End:976 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000155354 
Target Start:1136 
Target End:1156 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000146640 
Target Start:1078 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1078 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000297978 
Target Start:794 
Target End:814 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000262141 
Target Start:845 
Target End:865 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000176265 
Target Start:704 
Target End:724 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:991 
Target End:1012 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:781 
Target End:802 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000170630 
Target Start:769 
Target End:790 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000161521 
Target Start:39 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGUCU -5' 
Inhibition Type:Cleavage 
MDP0000161521 
Target:MDP0000120398 
Target Start:39 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCACA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGUCU -5' 
Inhibition Type:Cleavage 
MDP0000120398 
Target:MDP0000528658 
Target Start:527 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000528658 
Target:MDP0000298182 
Target Start:617 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000298182 
Target:MDP0000310981 
Target Start:797 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACGA -5' 
Inhibition Type:Cleavage 
MDP0000310981 
Target:MDP0000160621 
Target Start:359 
Target End:379 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000160621 
Target:MDP0000911724 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000911724 
Target:MDP0000121265 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000121265 
Target:MDP0000283465 
Target Start:2740 
Target End:2759 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACCUCUUGGUCCCGUAAACG -5' 
Inhibition Type:Cleavage 
MDP0000283465 
Target:MDP0000349606 
Target Start:24 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCCGAGRCCGA -5' 
Inhibition Type:Cleavage 
MDP0000349606 
Target:MDP0000179295 
Target Start:703 
Target End:723 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUUUUCCUUACGUGAACGA -5' 
Inhibition Type:Translation 
MDP0000179295 
Target:MDP0000303642 
Target Start:880 
Target End:900 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUUUUCCUUACGUGAACGA -5' 
Inhibition Type:Translation 
MDP0000303642 
Target:MDP0000258463 
Target Start:1226 
Target End:1246 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000258463 
Target:MDP0000139824 
Target Start:1325 
Target End:1345 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000139824 
Target:MDP0000294776 
Target Start:469 
Target End:488 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUCGAUG -5' 
Inhibition Type:Cleavage 
MDP0000294776 
Target:MDP0000319220 
Target Start:469 
Target End:488 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUCGAUG -5' 
Inhibition Type:Cleavage 
MDP0000319220 
Target:MDP0000271887 
Target Start:94 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000271887 
Target:MDP0000231542 
Target Start:405 
Target End:424 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGAGUCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000301081 
Target Start:1318 
Target End:1338 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGGCCUGGUUUGAACUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000301081 
Target:MDP0000305463 
Target Start:380 
Target End:400 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGAGCUUGGACAGAAGUAAGG -5' 
Inhibition Type:Translation 
MDP0000305463 
Target:MDP0000161945 
Target Start:237 
Target End:256 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- UGAACCUGGUUCGAAGUAAG -5' 
Inhibition Type:Cleavage 
MDP0000161945 
Target:MDP0000133490 
Target Start:237 
Target End:256 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- UGAACCUGGUUCGAAGUAAG -5' 
Inhibition Type:Cleavage 
MDP0000133490 
Target:MDP0000177486 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGUGCCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
MDP0000177486 
Target:MDP0000144105 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGUGCCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
MDP0000144105 
Target:MDP0000319153 
Target Start:3351 
Target End:3370 
miRNA Aligned Fragment:5'-CGCUAUCCAUCCUGAGUUUC-3' 
Target Aligned Fragment:3'- GCGAUAGGAAGGGCUAAAAG -5' 
Inhibition Type:Translation 
MDP0000319153 
Target:MDP0000319153 
Target Start:3351 
Target End:3370 
miRNA Aligned Fragment:5'-CGCUAUCCAUCCUGAGUUUC-3' 
Target Aligned Fragment:3'- GCGAUAGGAAGGGCUAAAAG -5' 
Inhibition Type:Translation 
MDP0000319153 
Target:MDP0000159463 
Target Start:411 
Target End:431 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- GCGACGACUCUUUUGCACCCU -5' 
Inhibition Type:Cleavage 
MDP0000159463 
Target:MDP0000190530 
Target Start:243 
Target End:263 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- CCUACCACUCUUUUACAUCCU -5' 
Inhibition Type:Cleavage 
MDP0000190530 
Target:MDP0000161508 
Target Start:243 
Target End:263 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- CCUACCACUCUUUUACAUCCU -5' 
Inhibition Type:Cleavage 
MDP0000161508 
Target:MDP0000416548 
Target Start:46 
Target End:66 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- UCGACGUCUUUUUUACGUCCU -5' 
Inhibition Type:Cleavage 
MDP0000416548 
Target:MDP0000127542 
Target Start:46 
Target End:66 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- UCGACGUCUUUUUUACGUCCU -5' 
Inhibition Type:Cleavage 
MDP0000127542 
Target:MDP0000283384 
Target Start:51 
Target End:71 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- CUGACGACUCGUUUACGUCGU -5' 
Inhibition Type:Translation 
MDP0000283384 
Target:MDP0000294700 
Target Start:751 
Target End:771 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- CCGACGACUUUUUUUUAUACU -5' 
Inhibition Type:Cleavage 
MDP0000294700 
Target:MDP0000123097 
Target Start:1917 
Target End:1937 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGGA-3' 
Target Aligned Fragment:3'- UCGACGACUGUAUUACGUCCU -5' 
Inhibition Type:Translation 
MDP0000123097 
Target:MDP0000258428 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-GGCUGCUGAGAAAAUGUAGG-3' 
Target Aligned Fragment:3'- CUGACGAUUCUUUUACCUUU -5' 
Inhibition Type:Cleavage 
MDP0000258428 
Target:MDP0000784909 
Target Start:1226 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1355 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1379 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1907 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000302855 
Target Start:890 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUACA -5' 
Inhibition Type:Translation 
MDP0000302855 
Target:MDP0000892979 
Target Start:198 
Target End:218 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000892979 
Target:MDP0000417953 
Target Start:198 
Target End:218 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000417953 
Target:MDP0000895750 
Target Start:219 
Target End:239 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000895750 
Target:MDP0000399538 
Target Start:228 
Target End:248 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUCAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000399538 
Target:MDP0000125891 
Target Start:105 
Target End:124 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUGAGGUGUAGGACUCCAAA -5' 
Inhibition Type:Cleavage 
MDP0000125891 
Target:MDP0000200895 
Target Start:814 
Target End:833 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- UUUAGACGUUGGACUCGAAA -5' 
Inhibition Type:Translation 
MDP0000200895 
Target:MDP0000332753 
Target Start:222 
Target End:241 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- AUUAGACGUGGGAUUAGAAA -5' 
Inhibition Type:Cleavage 
MDP0000332753 
Target:MDP0000254078 
Target Start:202 
Target End:221 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
MDP0000254078 
Target:MDP0000154994 
Target Start:670 
Target End:689 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
MDP0000154994 
Target:MDP0000190060 
Target Start:733 
Target End:752 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
MDP0000190060 
Target:MDP0000121656 
Target Start:334 
Target End:354 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000121656 
Target:MDP0000263161 
Target Start:1657 
Target End:1677 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000263161 
Target:MDP0000718765 
Target Start:609 
Target End:629 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000718765 
Target:MDP0000573746 
Target Start:609 
Target End:629 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000573746 
Target:MDP0000935996 
Target Start:315 
Target End:334 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- AACUUCACAAAUCCUCUUGC -5' 
Inhibition Type:Cleavage 
MDP0000935996 
Target:MDP0000266051 
Target Start:1048 
Target End:1067 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- UACUUCACGAACCUUUUUGA -5' 
Inhibition Type:Cleavage 
MDP0000266051 
Target:MDP0000295518 
Target Start:801 
Target End:820 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- GACUUCWCAAACCUCCAUGU -5' 
Inhibition Type:Cleavage 
MDP0000295518 
Target:MDP0000175678 
Target Start:210 
Target End:230 
miRNA Aligned Fragment:5'-UUAGAUUCACGCACAAACUCG-3' 
Target Aligned Fragment:3'- AAUCAAAGUGGGUGUUUGAGC -5' 
Inhibition Type:Translation 
MDP0000175678 
Target:MDP0000272603 
Target Start:1980 
Target End:1999 
miRNA Aligned Fragment:5'-UUAGAUUCACGCACAAACUCG-3' 
Target Aligned Fragment:3'- AAUCUAGGUGU-UGUUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000272603 
Target:MDP0000757833 
Target Start:43 
Target End:63 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCUU-3' 
Target Aligned Fragment:3'- ACCUUGACUUCCUUUGAGGAG -5' 
Inhibition Type:Cleavage 
MDP0000757833 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000194772 
Target Start:312 
Target End:332 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCUU-3' 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUAA -5' 
Inhibition Type:Translation 
MDP0000194772 
Target:MDP0000296691 
Target Start:312 
Target End:332 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCUU-3' 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUAA -5' 
Inhibition Type:Translation 
MDP0000296691 
Target:MDP0000237553 
Target Start:298 
Target End:317 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000237553 
Target:MDP0000442611 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000287069 
Target Start:1180 
Target End:1199 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000287069 
Target:MDP0000763497 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000763497 
Target:MDP0000927314 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000927314 
Target:MDP0000920127 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000920127 
Target:MDP0000168665 
Target Start:2649 
Target End:2668 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AGCCUGGCUUACCUUGGGGA -5' 
Inhibition Type:Translation 
MDP0000168665 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000302021 
Target Start:516 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGU -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000506954 
Target Start:263 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
MDP0000506954 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000296582 
Target Start:1091 
Target End:1111 
miRNA Aligned Fragment:5'-UGAAGCUGCCAGCAUGAUCUU-3' 
Target Aligned Fragment:3'- ACUUUGAUUGUCGUACUCGAA -5' 
Inhibition Type:Translation 
MDP0000296582 
Target:MDP0000283804 
Target Start:205 
Target End:226 
miRNA Aligned Fragment:5'-UGAAGCUGCCA-GCAUGAUCUU-3' 
Target Aligned Fragment:3'- ACUUCGACUGUCCGUACUAGGA -5' 
Inhibition Type:Translation 
MDP0000283804 
Target:MDP0000171742 
Target Start:384 
Target End:403 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAACAAAAACAAAA -5' 
Inhibition Type:Translation 
MDP0000171742 
Target:MDP0000292326 
Target Start:56 
Target End:75 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAACUAAAACAGGA -5' 
Inhibition Type:Cleavage 
MDP0000292326 
Target:MDP0000369858 
Target Start:471 
Target End:490 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- ACCAACAAACCGAGACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000369858 
Target:MDP0000131094 
Target Start:670 
Target End:689 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACGAACCAAAACUAAA -5' 
Inhibition Type:Cleavage 
MDP0000131094 
Target:MDP0000143585 
Target Start:703 
Target End:722 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACGAACCAAAACUAAA -5' 
Inhibition Type:Cleavage 
MDP0000143585 
Target:MDP0000123086 
Target Start:1360 
Target End:1379 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAAACCAAAGCAGUG -5' 
Inhibition Type:Cleavage 
MDP0000123086 
Target:MDP0000161558 
Target Start:209 
Target End:228 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAAUCGAAGCAAAC -5' 
Inhibition Type:Cleavage 
MDP0000161558 
Target:MDP0000247495 
Target Start:5654 
Target End:5673 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- CUCAACGAACCAAAAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000247495 
Target:MDP0000282171 
Target Start:337 
Target End:356 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAAUAUAUCAAAACGAAA -5' 
Inhibition Type:Cleavage 
MDP0000282171 
Target:MDP0000724726 
Target Start:977 
Target End:996 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACCAGCCAGAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000724726 
Target:MDP0000147266 
Target Start:952 
Target End:971 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAAAUCAAAGUAUAA -5' 
Inhibition Type:Cleavage 
MDP0000147266 
Target:MDP0000217823 
Target Start:1493 
Target End:1512 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUUGACGAACUAAAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000217823 
Target:MDP0000296541 
Target Start:2120 
Target End:2139 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAACUCGAAACAAAG -5' 
Inhibition Type:Translation 
MDP0000296541 
Target:MDP0000718765 
Target Start:608 
Target End:629 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUCC-3' 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000718765 
Target:MDP0000573746 
Target Start:608 
Target End:629 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUCC-3' 
Target Aligned Fragment:3'- GGCUUCACGGACCCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000573746 
Target:MDP0000121656 
Target Start:334 
Target End:354 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000121656 
Target:MDP0000263161 
Target Start:1657 
Target End:1677 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- UACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000263161 
Target:MDP0000935996 
Target Start:315 
Target End:334 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- AACUUCACAAAUCCUCUUGC -5' 
Inhibition Type:Cleavage 
MDP0000935996 
Target:MDP0000266051 
Target Start:1048 
Target End:1067 
miRNA Aligned Fragment:5'-CUGAAGUGUUUGGGGGAACU-3' 
Target Aligned Fragment:3'- UACUUCACGAACCUUUUUGA -5' 
Inhibition Type:Cleavage 
MDP0000266051 
Target:MDP0000212192 
Target Start:363 
Target End:382 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCACAUGACACCUAUA -5' 
Inhibition Type:Translation 
MDP0000212192 
Target:MDP0000846748 
Target Start:1413 
Target End:1432 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCACAUGACACCUAUA -5' 
Inhibition Type:Translation 
MDP0000846748 
Target:MDP0000128251 
Target Start:1278 
Target End:1297 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCAAACUAUACCUGUA -5' 
Inhibition Type:Cleavage 
MDP0000128251 
Target:MDP0000454047 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- GACUUUACGCUAGACCUAUA -5' 
Inhibition Type:Cleavage 
MDP0000454047 
Target:MDP0000287262 
Target Start:1218 
Target End:1237 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- AACUUUACGCUAGACCUAUA -5' 
Inhibition Type:Cleavage 
MDP0000287262 
Target:MDP0000292367 
Target Start:3472 
Target End:3491 
miRNA Aligned Fragment:5'-AUGAAGUGUGAUGUGGAUAU-3' 
Target Aligned Fragment:3'- UACUUCAGACUAGGUCUAUA -5' 
Inhibition Type:Cleavage 
MDP0000292367 
Target:MDP0000121656 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000121656 
Target:MDP0000263161 
Target Start:1657 
Target End:1676 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000263161 
Target:MDP0000293087 
Target Start:532 
Target End:551 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUAUAAACUUUCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000293087 
Target:MDP0000935996 
Target Start:314 
Target End:333 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCACAAAUCCUCUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000935996 
Target:MDP0000266051 
Target Start:1047 
Target End:1066 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCACGAACCUUUUUGAU -5' 
Inhibition Type:Cleavage 
MDP0000266051 
Target:MDP0000301372 
Target Start:326 
Target End:345 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GCUUCACAACCCCCUUUGGG -5' 
Inhibition Type:Translation 
MDP0000301372 
Target:MDP0000862901 
Target Start:339 
Target End:358 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000862901 
Target:MDP0000902543 
Target Start:535 
Target End:554 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUAUAGACUUUCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000902543 
Target:MDP0000718631 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000718631 
Target:MDP0000271544 
Target Start:266 
Target End:285 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- AUUUUACGAACUUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000271544 
Target:MDP0000729657 
Target Start:1277 
Target End:1296 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GCUUCACAACCCCCUUUGGG -5' 
Inhibition Type:Translation 
MDP0000729657 
Target:MDP0000608985 
Target Start:924 
Target End:943 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000608985 
Target:MDP0000333807 
Target Start:831 
Target End:850 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCGUAAACUCGUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000333807 
Target:MDP0000132186 
Target Start:116 
Target End:135 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCGCGCAUCUCCUUGAG -5' 
Inhibition Type:Translation 
MDP0000132186 
Target:MDP0000194500 
Target Start:31 
Target End:50 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAACUCGUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000194500 
Target:MDP0000431628 
Target Start:791 
Target End:810 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GAGAGGGAGUUUCCGAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000431628 
Target:MDP0000464809 
Target Start:2054 
Target End:2073 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- AGGAGGGAGUUUCCGAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000464809 
Target:MDP0000147173 
Target Start:497 
Target End:516 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- AAGAGGGAGGUUCCGAAGGU -5' 
Inhibition Type:Translation 
MDP0000147173 
Target:MDP0000180494 
Target Start:690 
Target End:709 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GGGAGGGUGUUUCUGAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000180494 
Target:MDP0000319525 
Target Start:690 
Target End:709 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GGGAGGGUGUUUCUGAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000319525 
Target:MDP0000677637 
Target Start:2233 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGAA -5' 
Inhibition Type:Cleavage 
MDP0000677637 
Target:MDP0000193012 
Target Start:361 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGAG -5' 
Inhibition Type:Cleavage 
MDP0000193012 
Target:MDP0000501816 
Target Start:361 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGAG -5' 
Inhibition Type:Cleavage