AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR1030j

miR1030j  

Mature Sequence:5'-CCTGCATCTGCACCTGCACCA-3'

Precursor Sequence:

_

Genome Location:Chr3:26130554..26130534
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000261181 
Target Start:46 
Target End:65 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000261181 
Target:MDP0000147872 
Target Start:232 
Target End:251 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUAAACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000147872 
Target:MDP0000196131 
Target Start:367 
Target End:386 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUAAACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000196131 
Target:MDP0000667488 
Target Start:2505 
Target End:2525 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- CGACGUGGACUUGGACGUGGU -5' 
Inhibition Type:Translation 
MDP0000667488 
Target:MDP0000578751 
Target Start:1080 
Target End:1100 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- CGACGUGGACUUGGACGUGGU -5' 
Inhibition Type:Translation 
MDP0000578751 
Target:MDP0000198217 
Target Start:727 
Target End:746 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGUCGUGGACGUGGACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000198217 
Target:MDP0000183627 
Target Start:1227 
Target End:1247 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGACGUGGWCGUUGACGUGGY -5' 
Inhibition Type:Cleavage 
MDP0000183627 
Target:MDP0000270855 
Target Start:1086 
Target End:1106 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGACGUGGWCGUUGACGUGGY -5' 
Inhibition Type:Cleavage 
MDP0000270855 
Target:MDP0000179855 
Target Start:678 
Target End:698 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGACGUGAACGUGAACGUGGU -5' 
Inhibition Type:Cleavage 
MDP0000179855 
Target:MDP0000120635 
Target Start:382 
Target End:401 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGAACGUGU -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000171737 
Target Start:363 
Target End:383 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- AGACGUAGACGUAGACGUAGU -5' 
Inhibition Type:Cleavage 
MDP0000171737 
Target:MDP0000324028 
Target Start:2 
Target End:22 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACCA-3' 
Target Aligned Fragment:3'- GGASGUGGAGGUGGAGGUGGU -5' 
Inhibition Type:Translation 
MDP0000324028 
Target:MDP0000193325 
Target Start:1633 
Target End:1652 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GAACGUGGACGUGAACGUGG -5' 
Inhibition Type:Cleavage 
MDP0000193325 
Target:MDP0000315677 
Target Start:40 
Target End:59 
miRNA Aligned Fragment:5'-CCUGCAUCUGCACCUGCACC-3' 
Target Aligned Fragment:3'- GGACGUGGACGUGGAGGUCG -5' 
Inhibition Type:Cleavage 
MDP0000315677 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested