AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR1046

miR1046  
Target:MDP0000129677 
Target Start:597 
Target End:616 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- UCCUGGAGUGUAAAACGGUC -5' 
Inhibition Type:Cleavage 
MDP0000129677 
Target:MDP0000196399 
Target Start:682 
Target End:701 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- AUUUGAAGUGUAAGGCGAUC -5' 
Inhibition Type:Cleavage 
MDP0000196399 
Target:MDP0000308743 
Target Start:775 
Target End:794 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- AUUUGAAGUGUAAGGCGAUC -5' 
Inhibition Type:Cleavage 
MDP0000308743 
Target:MDP0000196040 
Target Start:3463 
Target End:3482 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- ACCUAAAGUGUAAAACCAUA -5' 
Inhibition Type:Cleavage 
MDP0000196040 
Target:MDP0000308416 
Target Start:2986 
Target End:3005 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- ACCUAAAGUGUAAAACCAUA -5' 
Inhibition Type:Cleavage 
MDP0000308416 
Target:MDP0000257501 
Target Start:454 
Target End:473 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- UCCUAAGGUAUCGAACGAUC -5' 
Inhibition Type:Cleavage 
MDP0000257501 
Target:MDP0000684656 
Target Start:508 
Target End:527 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- GCCUAAGGUACGAGACGAUC -5' 
Inhibition Type:Translation 
MDP0000684656 
Target:MDP0000670775 
Target Start:427 
Target End:446 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- ACCUAAGGUAGAAAGCGGUU -5' 
Inhibition Type:Translation 
MDP0000670775 
Target:MDP0000663084 
Target Start:427 
Target End:446 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- ACCUAAGGUAGAAAGCGGUU -5' 
Inhibition Type:Translation 
MDP0000663084 
Target:MDP0000147906 
Target Start:1087 
Target End:1106 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- GCUUAGAGUGUAAAACGUUC -5' 
Inhibition Type:Cleavage 
MDP0000147906 
Target:MDP0000157686 
Target Start:1087 
Target End:1106 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- GCUUAGAGUGUAAAACGUUC -5' 
Inhibition Type:Cleavage 
MDP0000157686 
Target:MDP0000156411 
Target Start:1117 
Target End:1136 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- GCUUAGAGUGUAAAACGUUC -5' 
Inhibition Type:Cleavage 
MDP0000156411 
Target:MDP0000180405 
Target Start:808 
Target End:827 
miRNA Aligned Fragment:5'-UGGAUUUCAUAUUUUGCUAG-3' 
Target Aligned Fragment:3'- ACUUGAAGUAUAAAGUUAUC -5' 
Inhibition Type:Cleavage 
MDP0000180405 
Data resource:
Huaping Yu et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested