AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR1187

miR1187  

Mature Sequence:5'-TATGTGTGTGTGTATGTGTGTAA-3'

Precursor Sequence:

_

Genome Location:Chr15:19927026..19927004
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000260932 
Target Start:1330 
Target End:1351 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- AUACACACACACACACACACAU -5' 
Inhibition Type:Cleavage 
MDP0000260932 
Target:MDP0000172751 
Target Start:189 
Target End:210 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- AUAUACAUAUACAUAUACACAU -5' 
Inhibition Type:Cleavage 
MDP0000172751 
Target:MDP0000176447 
Target Start:479 
Target End:499 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGU-3' 
Target Aligned Fragment:3'- AUACACACACACACACACACA -5' 
Inhibition Type:Cleavage 
MDP0000176447 
Target:MDP0000144861 
Target Start:1245 
Target End:1266 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- UUAGACACACACAUACACACAU -5' 
Inhibition Type:Cleavage 
MDP0000144861 
Target:MDP0000362128 
Target Start:74 
Target End:95 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- UUACAUACACACAUAUAUAUAU -5' 
Inhibition Type:Cleavage 
MDP0000362128 
Target:MDP0000247149 
Target Start:729 
Target End:749 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGU-3' 
Target Aligned Fragment:3'- AUACACACACAGGUACACACA -5' 
Inhibition Type:Cleavage 
MDP0000247149 
Target:MDP0000356382 
Target Start:27 
Target End:47 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGU-3' 
Target Aligned Fragment:3'- ASACACACACACACACACACA -5' 
Inhibition Type:Cleavage 
MDP0000356382 
Target:MDP0000897593 
Target Start:793 
Target End:813 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGU-3' 
Target Aligned Fragment:3'- AUACACAUUCACAUGCACACA -5' 
Inhibition Type:Translation 
MDP0000897593 
Target:MDP0000347332 
Target Start:328 
Target End:349 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- AUAUAUAUAUAAAUACACACAU -5' 
Inhibition Type:Cleavage 
MDP0000347332 
Target:MDP0000264125 
Target Start:441 
Target End:462 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- AUAUAUAAAUACAUACAUACAU -5' 
Inhibition Type:Cleavage 
MDP0000264125 
Target:MDP0000470442 
Target Start:602 
Target End:623 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- AUACAMAUAUACAUAUGCAUGU -5' 
Inhibition Type:Cleavage 
MDP0000470442 
Target:MDP0000267912 
Target Start:324 
Target End:345 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUA-3' 
Target Aligned Fragment:3'- AUACAUACAUACGUACAUACCU -5' 
Inhibition Type:Cleavage 
MDP0000267912 
Target:MDP0000336000 
Target Start:100 
Target End:122 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUAA-3' 
Target Aligned Fragment:3'- AAACACACACACACACACACACU -5' 
Inhibition Type:Cleavage 
MDP0000336000 
Target:MDP0000258998 
Target Start:4071 
Target End:4093 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGUAA-3' 
Target Aligned Fragment:3'- AUAUAUACACACACACAUACAGU -5' 
Inhibition Type:Cleavage 
MDP0000258998 
Target:MDP0000290270 
Target Start:249 
Target End:269 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGU-3' 
Target Aligned Fragment:3'- AUGUACACGCACACACACACA -5' 
Inhibition Type:Cleavage 
MDP0000290270 
Target:MDP0000280643 
Target Start:1519 
Target End:1539 
miRNA Aligned Fragment:5'-UAUGUGUGUGUGUAUGUGUGU-3' 
Target Aligned Fragment:3'- AUGCACACACAUGUAUAUACG -5' 
Inhibition Type:Cleavage 
MDP0000280643 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested