AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR156a

miR156a  

Mature Sequence:5'-TGACAGAAGAGAGTGAGCAC-3'

Precursor Sequence:

TTGGACTTAGGGTAGAAATTGACAGAAGAGAGTGAGCACACAGAGGCACTTGCCATAAAG
CGTATGCCATTGCTTTTGCGTGCTCATGTCTCTTTCTGTCAGCTTCCCCATTTCCACTGC
CGGATTAATATTAATTTTTTCATTTCTTCCTTCACACCCCCTCCCTTCTT

Genome Location:Chr1:26393476..26393495
Precursor Coordinates:181..351
MFE:-55.2
MFEI:0.74
GC:44.12
Plant Homologs:

aly-miR156c;aly-miR156f;aly-miR156b;aly-miR156g;aly-miR156e;aly-miR156b*;aly-miR156a*;aly-miR156d;aly-miR156a;ath-miR156g;ath-miR156d;ath-miR156e;ath-miR156a;ath-miR156c;ath-miR156b;ath-miR156f;bna-miR156a;ghr-miR156c;ghr-miR156d;ghr-miR156a;ghr-miR156b;ppt-miR156c;ppt-miR156a;ppt-miR156b;tae-miR156;vvi-miR156b;vvi-miR156e;vvi-miR156c;vvi-miR156d;csi-miR156;gma-miR156a;hvu-miR156;mtr-miR156i;mtr-miR156d;mtr-miR156b;mtr-miR156c;rco-miR156c;rco-miR156b;rco-miR156d;rco-miR156a;smo-miR156a;zma-miR156h*;zma-miR156c;zma-miR156g*;zma-miR156g;zma-miR156b;zma-miR156f*;zma-miR156l;zma-miR156f;zma-miR156a;zma-miR156d*;zma-miR156i;zma-miR156h;zma-miR156k*;zma-miR156e;zma-miR156d;ctr-miR156;osa-miR156h;osa-miR156l;osa-miR156c;osa-miR156f;osa-miR156i;osa-miR156e;osa-miR156d;osa-miR156b;osa-miR156j;osa-miR156g;osa-miR156a;ptc-miR156a;ptc-miR156d;ptc-miR156b;ptc-miR156e;ptc-miR156f;ptc-miR156c;sbi-miR156i;sbi-miR156g;sbi-miR156a;sbi-miR156c;sbi-miR156f;sbi-miR156h;sbi-miR156b;sof-miR156;

Structure:
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000209716 
Target Start:564 
Target End:583 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000209716 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000276433 
Target Start:1509 
Target End:1528 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000276433 
Target:MDP0000263925 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000263925 
Target:MDP0000380605 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000380605 
Target:MDP0000165817 
Target Start:111 
Target End:130 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000165817 
Target:MDP0000295324 
Target Start:801 
Target End:820 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGUUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000295324 
Target:MDP0000606853 
Target Start:10 
Target End:29 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGUUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000606853 
Target:MDP0000589558 
Target Start:991 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000263766 
Target Start:955 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1027 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1027 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1075 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1021 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000146640 
Target Start:1078 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1078 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000322647 
Target Start:1006 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUGU -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000142582 
Target Start:781 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUGU -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000276433 
Target Start:1508 
Target End:1528 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000276433 
Target:MDP0000380605 
Target Start:662 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000380605 
Target:MDP0000263925 
Target Start:662 
Target End:682 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000263925 
Target:MDP0000165817 
Target Start:110 
Target End:130 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000165817 
Target:MDP0000209716 
Target Start:564 
Target End:583 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000209716 
Target:MDP0000349942 
Target Start:290 
Target End:310 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGUGAGCACA-3' 
Target Aligned Fragment:3'- GUUGUCUUCGCUCACUCGAGU -5' 
Inhibition Type:Translation 
MDP0000349942 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000170630 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Translation 
MDP0000170630 
Target:MDP0000130479 
Target Start:1720 
Target End:1739 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCUGUCUUCUUUAUUUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000130479 
Target:MDP0000128688 
Target Start:2316 
Target End:2335 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUUUCUUUUUUCUG -5' 
Inhibition Type:Cleavage 
MDP0000128688 
Data resource:
Gleave, AP et al.
Huaping Yu et al.
microPC
mirNEST
PMRD
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested