AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR156b

miR156b  

Mature Sequence:5'-ATGACAGAAGATAGAGAGCAC-3'

Precursor Sequence:

GACCGAGCCAAGTGGTTTAGGCCAGTAACTGGATTTTGTGTTGGATGTGATGACAGAAGA
TAGAGAGCACAACCCCTTGTGCTTTTTGGCGAGCCAGCAGCAGCTATTGGAAGCGGCTGC
TGCTGGCACGTGAAAGCTTGAGGGGCTGCTCGGTTGCCTGCAGCRGCTTTAGGGTCACTT
GCTTGCAAGAAAATAAAAGGTTCGTGTCCTGCTCCGTT

Genome Location:Chr6:23408948..23408967
Precursor Coordinates:150..371
MFE:-90.1
MFEI:0.78
GC:52.04
Plant Homologs:

ahy-miR156b-5p;aly-miR157c;aly-miR157b;aly-miR157a;aly-miR157d;ath-miR157b;ath-miR157d;ath-miR157a;ath-miR157c;bna-miR156c;bna-miR156b;sly-miR156b;sly-miR156c;sly-miR156a;vvi-miR156i;vvi-miR156g;vvi-miR156f;aqc-miR156a;aqc-miR156b;bol-miR157a;gma-miR156c;gma-miR156e;gma-miR156g;gma-miR156d;mtr-miR156e;mtr-miR156g;mtr-miR156h;mtr-miR156f;pta-miR156a;pta-miR156b;rco-miR156g;rco-miR156h;rco-miR156f;smo-miR156b;bra-miR157a;gra-miR157a;gra-miR157b;ptc-miR156i;ptc-miR156g;ptc-miR156h;ptc-miR156j

Structure:
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000171877 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000146640 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000778465 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000246046 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000297978 
Target:MDP0000170630 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000176265 
Target:MDP0000325736 
Target Start:39 
Target End:59 
miRNA Aligned Fragment:5'-UGACAGAAG-AUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCGUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000325736 
Target:MDP0000399057 
Target Start:1625 
Target End:1644 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCGGUCUUUUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000399057 
Target:MDP0000277391 
Target Start:1472 
Target End:1491 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- CCGGUCUUUUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000277391 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Translation 
MDP0000589558 
Target:MDP0000213066 
Target Start:10406 
Target End:10425 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAGCUCUUGGG -5' 
Inhibition Type:Cleavage 
MDP0000213066 
Target:MDP0000266073 
Target Start:2013 
Target End:2032 
miRNA Aligned Fragment:5'-UGACAGAAGAUAGAGAGCAC-3' 
Target Aligned Fragment:3'- GCUGUCUUUUGUCUCCUGUG -5' 
Inhibition Type:Cleavage 
MDP0000266073 
Target:MDP0000142582 
Target Start:779 
Target End:798 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUAUCUCUCGUGUUG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000170630 
Target Start:767 
Target End:786 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUAUCUCCCGUGUUG -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000193684 
Target Start:1433 
Target End:1452 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- UUCUUUUAUCUCACGUGUUG -5' 
Inhibition Type:Cleavage 
MDP0000193684 
Target:MDP0000252393 
Target Start:1576 
Target End:1595 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUYUCUUUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000252393 
Target:MDP0000119458 
Target Start:1025 
Target End:1044 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1025 
Target End:1044 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1073 
Target End:1092 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000146640 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000246046 
Target Start:1019 
Target End:1038 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000322647 
Target Start:1004 
Target End:1023 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000263766 
Target Start:953 
Target End:972 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGUCA -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000211834 
Target Start:1433 
Target End:1452 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUUUAUCUCACGUGGUG -5' 
Inhibition Type:Cleavage 
MDP0000211834 
Target:MDP0000163637 
Target Start:50 
Target End:69 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUUUUCUAACUCUCGUUUUG -5' 
Inhibition Type:Translation 
MDP0000163637 
Target:MDP0000325736 
Target Start:37 
Target End:56 
miRNA Aligned Fragment:5'-CAGAAG-AUAGAGAGCACAA-3' 
Target Aligned Fragment:3'- GUCUUCGUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000325736 
Target:MDP0000249364 
Target Start:2711 
Target End:2730 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGCUA -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000155354 
Target Start:1133 
Target End:1152 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- GUCUUCUCUCUCUCGUGCUA -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000120398 
Target Start:37 
Target End:56 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- CUCUUCUCUCUCUCGUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000120398 
Target:MDP0000161521 
Target Start:37 
Target End:56 
miRNA Aligned Fragment:5'-CAGAAGAUAGAGAGCACAAC-3' 
Target Aligned Fragment:3'- CUCUUCUCUCUCUCGUCUUG -5' 
Inhibition Type:Cleavage 
MDP0000161521 
Data resource:
microPC
mirNEST
PMRD
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested