AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR156c

miR156c  

Mature Sequence:5'-TTGACAGAAGAGAGAGAGCAC-3'

Precursor Sequence:

_

Genome Location:Chr10:33063624..33063644
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000249364 
Target Start:2714 
Target End:2734 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000155354 
Target Start:1136 
Target End:1156 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000322647 
Target Start:1007 
Target End:1027 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000297978 
Target Start:794 
Target End:814 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000119458 
Target Start:1028 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000193702 
Target Start:1028 
Target End:1048 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1096 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000246046 
Target Start:1022 
Target End:1042 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- GACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000263766 
Target Start:956 
Target End:976 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000146640 
Target Start:1079 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000778465 
Target Start:1079 
Target End:1099 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000262141 
Target Start:845 
Target End:865 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000176265 
Target Start:704 
Target End:724 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:992 
Target End:1012 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:782 
Target End:802 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000161521 
Target Start:41 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGU -5' 
Inhibition Type:Cleavage 
MDP0000161521 
Target:MDP0000120398 
Target Start:41 
Target End:60 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCA-3' 
Target Aligned Fragment:3'- AACACUCUUCUCUCUCUCGU -5' 
Inhibition Type:Cleavage 
MDP0000120398 
Target:MDP0000170630 
Target Start:770 
Target End:790 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- UACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000717179 
Target Start:231 
Target End:251 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUCUACUCUUUUUGGUG -5' 
Inhibition Type:Translation 
MDP0000717179 
Target:MDP0000209716 
Target Start:564 
Target End:584 
miRNA Aligned Fragment:5'-UUGACAGAAGAGAGAGAGCAC-3' 
Target Aligned Fragment:3'- AACUGUUUUCUUUCGCUCGAG -5' 
Inhibition Type:Cleavage 
MDP0000209716 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested