AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR156d*

miR156d*  

Mature Sequence:5'-GCTCACTTCTCTTTCTGTCAGC-3'

Precursor Sequence:

_

Genome Location:Chr15:8289708..8289687
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000161195 
Target Start:1195 
Target End:1216 
miRNA Aligned Fragment:5'-GCUCACUUCUCUUUCUGUCAGC-3' 
Target Aligned Fragment:3'- AGAGAGAGGAGAAAGACAGUUG -5' 
Inhibition Type:Cleavage 
MDP0000161195 
Target:MDP0000282740 
Target Start:161 
Target End:180 
miRNA Aligned Fragment:5'-GCUCACUUCUCUUUCUGUCA-3' 
Target Aligned Fragment:3'- GGAGUGAAGAGAGAGACAGG -5' 
Inhibition Type:Cleavage 
MDP0000282740 
Target:MDP0000247490 
Target Start:887 
Target End:906 
miRNA Aligned Fragment:5'-GCUCACUUCUCUUUCUGUCA-3' 
Target Aligned Fragment:3'- CGAGAGAAGAGGAAGACGGU -5' 
Inhibition Type:Cleavage 
MDP0000247490 
Target:MDP0000322440 
Target Start:887 
Target End:906 
miRNA Aligned Fragment:5'-GCUCACUUCUCUUUCUGUCA-3' 
Target Aligned Fragment:3'- CGAGAGAAGAGGAAGACGGU -5' 
Inhibition Type:Cleavage 
MDP0000322440 
Target:MDP0000319753 
Target Start:2104 
Target End:2124 
miRNA Aligned Fragment:5'-GCUCACUUCUCUUUCUGUCAG-3' 
Target Aligned Fragment:3'- UGAGUGGGGAGAGAGAGAGUC -5' 
Inhibition Type:Cleavage 
MDP0000319753 
Target:MDP0000167289 
Target Start:59 
Target End:78 
miRNA Aligned Fragment:5'-GCUCACUUCUCUUUCUGUCA-3' 
Target Aligned Fragment:3'- GGAGUGAAGAGAAAGAGAGC -5' 
Inhibition Type:Cleavage 
MDP0000167289 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested