AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR156g

miR156g  

Mature Sequence:5'-ACAGAAGATAGAGAGCACAG-3'

Precursor Sequence:

_

Genome Location:Chr6:23408950..23408969
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000142582 
Target Start:780 
Target End:799 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000142582 
Target:MDP0000263766 
Target Start:954 
Target End:973 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000263766 
Target:MDP0000119458 
Target Start:1026 
Target End:1045 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000119458 
Target:MDP0000193702 
Target Start:1026 
Target End:1045 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000193702 
Target:MDP0000171877 
Target Start:1074 
Target End:1093 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000171877 
Target:MDP0000146640 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000146640 
Target:MDP0000778465 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000778465 
Target:MDP0000246046 
Target Start:1020 
Target End:1039 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000246046 
Target:MDP0000322647 
Target Start:1005 
Target End:1024 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000322647 
Target:MDP0000170630 
Target Start:768 
Target End:787 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUAUCUCCCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000170630 
Target:MDP0000252393 
Target Start:1577 
Target End:1596 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- CGUCUUCUYUCUUUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000252393 
Target:MDP0000399057 
Target Start:1623 
Target End:1642 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- GGUCUUUUAUCUCUCGUGGC -5' 
Inhibition Type:Cleavage 
MDP0000399057 
Target:MDP0000277391 
Target Start:1470 
Target End:1489 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- GGUCUUUUAUCUCUCGUGGC -5' 
Inhibition Type:Cleavage 
MDP0000277391 
Target:MDP0000589558 
Target Start:990 
Target End:1009 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCGCUCGUGUC -5' 
Inhibition Type:Translation 
MDP0000589558 
Target:MDP0000297978 
Target Start:792 
Target End:811 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCC -5' 
Inhibition Type:Translation 
MDP0000297978 
Target:MDP0000232031 
Target Start:262 
Target End:281 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUGUUUUUGGUGUC -5' 
Inhibition Type:Cleavage 
MDP0000232031 
Target:MDP0000131279 
Target Start:262 
Target End:281 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUGUUUUUGGUGUC -5' 
Inhibition Type:Cleavage 
MDP0000131279 
Target:MDP0000249364 
Target Start:2712 
Target End:2731 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCU -5' 
Inhibition Type:Translation 
MDP0000249364 
Target:MDP0000155354 
Target Start:1134 
Target End:1153 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCU -5' 
Inhibition Type:Translation 
MDP0000155354 
Target:MDP0000262141 
Target Start:843 
Target End:862 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCUCUCUCUCGUGCA -5' 
Inhibition Type:Translation 
MDP0000262141 
Target:MDP0000325736 
Target Start:37 
Target End:57 
miRNA Aligned Fragment:5'-ACAGAAG-AUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUCGUAUCUCUCGUGUU -5' 
Inhibition Type:Cleavage 
MDP0000325736 
Target:MDP0000311497 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-ACAGAAGAUAGAGAGCACAG-3' 
Target Aligned Fragment:3'- UGUCUUUUAACUCUCGUUUC -5' 
Inhibition Type:Translation 
MDP0000311497 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested