AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR156h

miR156h  

Mature Sequence:5'-TGACAGAAGAGAGAGAGCAT-3'

Precursor Sequence:

_

Genome Location:Chr10:28138756..28138775
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000249364 
Target Start:2714 
Target End:2733 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000249364 
Target:MDP0000263766 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000263766 
Target:MDP0000119458 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000119458 
Target:MDP0000155354 
Target Start:1136 
Target End:1155 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000155354 
Target:MDP0000193702 
Target Start:1028 
Target End:1047 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000193702 
Target:MDP0000171877 
Target Start:1076 
Target End:1095 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000171877 
Target:MDP0000778465 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000778465 
Target:MDP0000246046 
Target Start:1022 
Target End:1041 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000246046 
Target:MDP0000146640 
Target Start:1079 
Target End:1098 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000146640 
Target:MDP0000322647 
Target Start:1007 
Target End:1026 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000322647 
Target:MDP0000262141 
Target Start:845 
Target End:864 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000262141 
Target:MDP0000297978 
Target Start:794 
Target End:813 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000297978 
Target:MDP0000176265 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCUCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000176265 
Target:MDP0000589558 
Target Start:992 
Target End:1011 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUCUCGCUCGUG -5' 
Inhibition Type:Cleavage 
MDP0000589558 
Target:MDP0000142582 
Target Start:782 
Target End:801 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCUCGUG -5' 
Inhibition Type:Translation 
MDP0000142582 
Target:MDP0000320690 
Target Start:2635 
Target End:2654 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACCGUCUUCUCUCUCUCCUA -5' 
Inhibition Type:Cleavage 
MDP0000320690 
Target:MDP0000286390 
Target Start:364 
Target End:383 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- AUCGUCUUCUGUCUCUCGUA -5' 
Inhibition Type:Translation 
MDP0000286390 
Target:MDP0000170630 
Target Start:770 
Target End:789 
miRNA Aligned Fragment:5'-UGACAGAAGAGAGAGAGCAU-3' 
Target Aligned Fragment:3'- ACUGUCUUCUAUCUCCCGUG -5' 
Inhibition Type:Translation 
MDP0000170630 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested