AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR157d*

miR157d*  

Mature Sequence:5'-GCTCTCTATGCTTCTGTCATC-3'

Precursor Sequence:

TGGGAGAGAGAAAGAGCAGGGAGTGATGATACATTGTTGACAGAAGATAGAGAGCACAGA
TGGATGACTTGCAATTGACTATGCATCTCACTCCTTTGTGCTCTCTATGCTTCTGTCATC
ACCTCGTTATATCTAGCTTCCTTGCCTCTCTCCACACCCGTGCACCTCCCA

Genome Location:Chr6:23409010..23409030
Precursor Coordinates:163..334
MFE:-77.5
MFEI:0.96
GC:47.37
Plant Homologs:

ahy-miR156b-3p;ahy-miR156b-5p;aly-miR157c;aly-miR157b*;aly-miR157d*;aly-miR157b;aly-miR157a*;aly-miR157a;ath-miR157b;ath-miR157a;ath-miR157c;bna-miR156c;bna-miR156b;sly-miR156b;sly-miR156c;sly-miR156a;vvi-miR156i;vvi-miR156g;vvi-miR156f;bol-miR157a;gma-miR156c;gma-miR156e;gma-miR156g;gma-miR156d;mtr-miR156e;mtr-miR156g;mtr-miR156h;mtr-miR156f;rco-miR156g;rco-miR156h;rco-miR156f;bra-miR157a;gra-miR157a;gra-miR157b;ptc-miR156i;ptc-miR156g;ptc-miR156h;ptc-miR156j;

Structure:
Target:MDP0000284115 
Target Start:151 
Target End:170 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACAGUA -5' 
Inhibition Type:Cleavage 
MDP0000284115 
Target:MDP0000291818 
Target Start:1789 
Target End:1808 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACAGUA -5' 
Inhibition Type:Cleavage 
MDP0000291818 
Target:MDP0000545249 
Target Start:460 
Target End:480 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
MDP0000545249 
Target:MDP0000256280 
Target Start:970 
Target End:990 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
MDP0000256280 
Target:MDP0000276665 
Target Start:916 
Target End:936 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGUGAGAUACGAAGACAGUCG -5' 
Inhibition Type:Cleavage 
MDP0000276665 
Target:MDP0000922352 
Target Start:347 
Target End:366 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGGUAUACGAGGACAGUA -5' 
Inhibition Type:Cleavage 
MDP0000922352 
Target:MDP0000301405 
Target Start:1792 
Target End:1811 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGUUACGGAGACGGUA -5' 
Inhibition Type:Cleavage 
MDP0000301405 
Target:MDP0000154590 
Target Start:2802 
Target End:2821 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAAGACGGUU -5' 
Inhibition Type:Cleavage 
MDP0000154590 
Target:MDP0000553601 
Target Start:3088 
Target End:3107 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAAGACGGUU -5' 
Inhibition Type:Cleavage 
MDP0000553601 
Target:MDP0000877582 
Target Start:408 
Target End:427 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAUACGAAGACUUUA -5' 
Inhibition Type:Cleavage 
MDP0000877582 
Target:MDP0000272991 
Target Start:17 
Target End:36 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- UGAGAGAUAGGGAGACAGUG -5' 
Inhibition Type:Translation 
MDP0000272991 
Target:MDP0000177665 
Target Start:414 
Target End:433 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGAGAGAUACGAAGACUUUA -5' 
Inhibition Type:Cleavage 
MDP0000177665 
Target:MDP0000207352 
Target Start:1360 
Target End:1379 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAU-3' 
Target Aligned Fragment:3'- CGGGAGAGGUGAAGACAGUG -5' 
Inhibition Type:Cleavage 
MDP0000207352 
Target:MDP0000273608 
Target Start:124 
Target End:144 
miRNA Aligned Fragment:5'-GCUCUCUAUGCUUCUGUCAUC-3' 
Target Aligned Fragment:3'- CGAGAGAGACGAUGAGAGUAG -5' 
Inhibition Type:Cleavage 
MDP0000273608 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested