AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR159a

miR159a  

Mature Sequence:5'-TTTGGATTGAAGGGAGCTCTA-3'

Precursor Sequence:

_

Genome Location:Chr6:23531338..23531358
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000552725 
Target Start:109 
Target End:129 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000552725 
Target:MDP0000280968 
Target Start:258 
Target End:278 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- GAACCUAAUUGUCCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000280968 
Target:MDP0000237596 
Target Start:100 
Target End:120 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000237596 
Target:MDP0000319634 
Target Start:586 
Target End:606 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000319634 
Target:MDP0000253886 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000144652 
Target Start:1673 
Target End:1693 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AAACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000144652 
Target:MDP0000141678 
Target Start:1640 
Target End:1660 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AAACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000141678 
Target:MDP0000196238 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000196238 
Target:MDP0000219570 
Target Start:225 
Target End:244 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000219570 
Target:MDP0000174389 
Target Start:991 
Target End:1010 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACUUAAUUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
MDP0000174389 
Target:MDP0000151688 
Target Start:933 
Target End:952 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000151688 
Target:MDP0000175835 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000175835 
Target:MDP0000179306 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAAUUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000179306 
Target:MDP0000562620 
Target Start:2648 
Target End:2667 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AGACCUGACUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
MDP0000562620 
Target:MDP0000312348 
Target Start:582 
Target End:602 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000312348 
Target:MDP0000236327 
Target Start:1047 
Target End:1067 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000236327 
Data resource:
Gleave, AP et al.
microPC
mirNEST
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested