AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR159c

miR159c  

Mature Sequence:5'-ATTGGAGTGAAGGGAGCTCCG-3'

Precursor Sequence:

_

Genome Location:Chr7:3731684..3731704
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000214352 
Target Start:1517 
Target End:1537 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- GAACCCCACUUCCUUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000214352 
Target:MDP0000138860 
Target Start:1589 
Target End:1609 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- GAACCCCACUUCCUUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000138860 
Target:MDP0000211225 
Target Start:2211 
Target End:2231 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACCUCACUUACUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000211225 
Target:MDP0000271448 
Target Start:1104 
Target End:1123 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- UAGCCUCGUUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000271448 
Target:MDP0000252305 
Target Start:398 
Target End:418 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000252305 
Target:MDP0000295160 
Target Start:404 
Target End:424 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000295160 
Target:MDP0000284209 
Target Start:623 
Target End:643 
miRNA Aligned Fragment:5'-AUUGGAGUGAAGGGAGCUCCG-3' 
Target Aligned Fragment:3'- AAACUUCACUUCGUUCGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000284209 
Data resource:
microPC
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested