AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR159d

miR159d  

Mature Sequence:5'-TTTGGATTGAAGGGAGCTCT-3'

Precursor Sequence:

GGAGCTCCTTGAAGTCCAAAAGAAGGTGATGCTGGGTGGATAGAGCTGCTGAGCTATGGA
TCCCAGAGTCCTATATATCCTATATCGCAGATCAGATCAGATGCGATCAGAAGGATGATA
GGCTTGTGGCTTGCATATCTCAGGAGCTGCATTACCTGTACGCTGCCTCTTTTTTTGGAT
TGAAGGGAGCTCT

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000552725 
Target Start:110 
Target End:129 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000552725 
Target:MDP0000253886 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000196238 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000196238 
Target:MDP0000280968 
Target Start:259 
Target End:278 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCUAAUUGUCCUCGAGA -5' 
Inhibition Type:Translation 
MDP0000280968 
Target:MDP0000219570 
Target Start:225 
Target End:244 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000219570 
Target:MDP0000237596 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000237596 
Target:MDP0000174389 
Target Start:991 
Target End:1010 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACUUAAUUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
MDP0000174389 
Target:MDP0000319634 
Target Start:587 
Target End:606 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000319634 
Target:MDP0000151688 
Target Start:933 
Target End:952 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000151688 
Target:MDP0000175835 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCAACCUUCCCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000175835 
Target:MDP0000179306 
Target Start:1077 
Target End:1096 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GAACCAAAUUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000179306 
Target:MDP0000562620 
Target Start:2648 
Target End:2667 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AGACCUGACUUUCUUUGGGA -5' 
Inhibition Type:Cleavage 
MDP0000562620 
Target:MDP0000312348 
Target Start:582 
Target End:602 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000312348 
Target:MDP0000236327 
Target Start:1047 
Target End:1067 
miRNA Aligned Fragment:5'-UUUGG-AUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCGUAACUUCUCUCGAGA -5' 
Inhibition Type:Cleavage 
MDP0000236327 
Target:MDP0000186465 
Target Start:377 
Target End:396 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000186465 
Target:MDP0000321809 
Target Start:264 
Target End:283 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCUAACUACCCUAGAGG -5' 
Inhibition Type:Translation 
MDP0000321809 
Target:MDP0000265970 
Target Start:601 
Target End:620 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACUUGACUUUCCUUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000265970 
Target:MDP0000189192 
Target Start:288 
Target End:307 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- AAACCUAACUACCCUAGAGG -5' 
Inhibition Type:Translation 
MDP0000189192 
Target:MDP0000216976 
Target Start:422 
Target End:441 
miRNA Aligned Fragment:5'-UUUGGAUUGAAGGGAGCUCU-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000216976 
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested