AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR159f

miR159f  

Mature Sequence:5'-TTGGATTGAAGGGAGCTCTA-3'

Precursor Sequence:

TGGAGCTCCTTGAAGTCCAAAAGAAGGTGATGCTGGGTGGATAGAGCTGCTGAGCTATGG
ATCCCAGAGTCCTATATATCCTATATCGCAGATCAGATCAGATGCGATCAGAAGGATGAT
AGGCTTGTGGCTTGCATATCTCAGGAGCTGCATTACCTGTACGCTGCCTCTTTTTTTGGA
TTGAAGGGAGCTCTA

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000280968 
Target Start:258 
Target End:277 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACCUAAUUGUCCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000280968 
Target:MDP0000552725 
Target Start:109 
Target End:128 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Translation 
MDP0000552725 
Target:MDP0000237596 
Target Start:100 
Target End:119 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Translation 
MDP0000237596 
Target:MDP0000319634 
Target Start:586 
Target End:605 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACCUAGCUUACCUCGAGGU -5' 
Inhibition Type:Translation 
MDP0000319634 
Target:MDP0000253886 
Target Start:722 
Target End:741 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACCAAACUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1088 
Target End:1107 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACCAAACUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000144652 
Target Start:1673 
Target End:1692 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000144652 
Target:MDP0000141678 
Target Start:1640 
Target End:1659 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACUUAGUAUCUCUCGAGAU -5' 
Inhibition Type:Translation 
MDP0000141678 
Target:MDP0000278120 
Target Start:144 
Target End:163 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACUUAAUUGUCCUCGAGGU -5' 
Inhibition Type:Translation 
MDP0000278120 
Target:MDP0000286959 
Target Start:144 
Target End:163 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACUUAAUUGUCCUCGAGGU -5' 
Inhibition Type:Translation 
MDP0000286959 
Target:MDP0000276010 
Target Start:144 
Target End:163 
miRNA Aligned Fragment:5'-UUGGAUUGAAGGGAGCUCUA-3' 
Target Aligned Fragment:3'- AACUUAAUUGUCCUCGAGGU -5' 
Inhibition Type:Translation 
MDP0000276010 
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested