AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR160a

miR160a  

Mature Sequence:5'-TGCCTGGCTCCCTGTATGCCA-3'

Precursor Sequence:

CAAAAGGTGACTTGGGTTATGCCTGGCTCCCTGTATGCCACAAGCAGAAGTTCAATTTCT
TGATTGGCTATTGTGGGTGGCGTACAAGGAGCCAAGCATACTATCTCTCTTTCTTTTAGT
CGTCTTGCATTCTGCTTTTGCTTGCACATATAAGATTTAAGTTCTTTGGTG

Genome Location:Chr1:14039861..14039841
Precursor Coordinates:180..351
MFE:-61.2
MFEI:0.84
GC:42.69
Plant Homologs:

ahy-miR160-5p;aly-miR160a;aly-miR160c*;aly-miR160c;aly-miR160b;ath-miR160c;ath-miR160a;ath-miR160b;far-miR160;ppt-miR160e;ppt-miR160i;ppt-miR160a;ppt-miR160b;ppt-miR160c;ppt-miR160d;ppt-miR160f;sly-miR160a;tae-miR160;vvi-miR160c;vvi-miR160b;vvi-miR160e;vvi-miR160a;vvi-miR160d;aqc-miR160b;aqc-miR160a;csi-miR160;gma-miR160;mtr-miR160;mtr-miR160d;mtr-miR160c;mtr-miR160e;mtr-miR160b;pab-miR160b;pab-miR160a;rco-miR160c;rco-miR160a;rco-miR160b;smo-miR160b;smo-miR160a;ttu-miR160;zma-miR160d;zma-miR160a;zma-miR160g;zma-miR160d*;zma-miR160g*;zma-miR160b*;zma-miR160f;zma-miR160c;zma-miR160b;zma-miR160e;bdi-miR160;bra-miR160a;osa-miR160d;osa-miR160f;osa-miR160a;osa-miR160b;osa-miR160e;osa-miR160c;ptc-miR160h;ptc-miR160f;ptc-miR160c;ptc-miR160e;ptc-miR160a;ptc-miR160d;ptc-miR160g;ptc-miR160b;sbi-miR160c;sbi-miR160f;sbi-miR160d;sbi-miR160e;sbi-miR160b;sbi-miR160a;

Structure:
Target:MDP0000750392 
Target Start:1764 
Target End:1784 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCCA-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
MDP0000750392 
Target:MDP0000120635 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000131481 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000131481 
Target:MDP0000221322 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000221322 
Target:MDP0000273491 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000273491 
Target:MDP0000232116 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000232116 
Target:MDP0000256621 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000256621 
Target:MDP0000776180 
Target Start:154 
Target End:173 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGUAUGCC-3' 
Target Aligned Fragment:3'- ACGGGCCGAAGGAGGUACGG -5' 
Inhibition Type:Translation 
MDP0000776180 
Data resource:
Varkonyi Gasic et al.
Wei et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested