AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR160a*

miR160a*  

Mature Sequence:5'-GCGTATGAGGAGCCATGCATA-3'

Precursor Sequence:

GATTCACGCATACATACATATACATGTATATATATATGTGCCTGGCTCCCTGTATGCCAT
TTGCAGAGTTCCACCGAACATCGATGGCCTCCGTGGATGGCGTATGAGGAGCCATGCATA
TAAAACCCATGTCCATGGCTGTGTCTCTTCATCTTGTTCTATTTCTTCTTC

Genome Location:Chr1:14039800..14039780
Precursor Coordinates:101..272
MFE:-61.7
MFEI:0.81
GC:44.44
Plant Homologs:

aly-miR160a*;csi-miR160;bra-miR160a*;

Structure:
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested