AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR160h

miR160h  

Mature Sequence:5'-TGCCTGGCTCCCTGCATGCCA-3'

Precursor Sequence:

CCAGTCAAGAAGCATGACGTGCCTGGCTCCCTGCATGCCATCTAAGCAAATTKTCAATAA
GAMTGCTGATTTTTCTTAGTTGGTATTCAGGGAGCCGTGCATGTCTAGCTGTTAGACTTA
CCGTCCGATCAACCGTCATCATGATGTGAAGTTTAAAGTCAATCATCTCCT

Genome Location:Chr9:9642379..9642399
Precursor Coordinates:2282..2453
MFE:-59.7
MFEI:0.8
GC:43.86
Plant Homologs:

ppt-miR160c;aqc-miR160a;ptc-miR160h;ptc-miR160g;

Structure:
Target:MDP0000750392 
Target Start:1764 
Target End:1784 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCCA-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGGU -5' 
Inhibition Type:Cleavage 
MDP0000750392 
Target:MDP0000256621 
Target Start:1612 
Target End:1631 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000256621 
Target:MDP0000232116 
Target Start:1303 
Target End:1322 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000232116 
Target:MDP0000273491 
Target Start:301 
Target End:320 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000273491 
Target:MDP0000221322 
Target Start:1597 
Target End:1616 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000221322 
Target:MDP0000131481 
Target Start:1507 
Target End:1526 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000131481 
Target:MDP0000120635 
Target Start:250 
Target End:269 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGACCGAGGGACAUACGG -5' 
Inhibition Type:Cleavage 
MDP0000120635 
Target:MDP0000167989 
Target Start:59 
Target End:79 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCCA-3' 
Target Aligned Fragment:3'- CCGGAUCGAGGGAUGAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000167989 
Target:MDP0000776180 
Target Start:154 
Target End:173 
miRNA Aligned Fragment:5'-UGCCUGGCUCCCUGCAUGCC-3' 
Target Aligned Fragment:3'- ACGGGCCGAAGGAGGUACGG -5' 
Inhibition Type:Translation 
MDP0000776180 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested