AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR162*

miR162*  

Mature Sequence:5'-TGGAGGCAGCGGTTCATCGATC-3'

Precursor Sequence:

_

Genome Location:Chr6:22415342..22415321
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000649405 
Target Start:60 
Target End:81 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGAUC-3' 
Target Aligned Fragment:3'- ACCUCCGUUGCCAAGUAACUCG -5' 
Inhibition Type:Cleavage 
MDP0000649405 
Target:MDP0000816713 
Target Start:851 
Target End:870 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGA-3' 
Target Aligned Fragment:3'- AUCUCUGUCGUCAAGUAGUU -5' 
Inhibition Type:Cleavage 
MDP0000816713 
Target:MDP0000214155 
Target Start:560 
Target End:579 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGA-3' 
Target Aligned Fragment:3'- ACUUCCGUCGCCGAGUAGAA -5' 
Inhibition Type:Cleavage 
MDP0000214155 
Target:MDP0000122582 
Target Start:925 
Target End:945 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- ACCUCCGACGACAAGUAGUUG -5' 
Inhibition Type:Translation 
MDP0000122582 
Target:MDP0000315352 
Target Start:1030 
Target End:1050 
miRNA Aligned Fragment:5'-UGGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- ACCUCCGACGACAAGUAGUUG -5' 
Inhibition Type:Translation 
MDP0000315352 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested