AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR162a

miR162a  

Mature Sequence:5'-TCGATAAACCTCTGCATCCAG-3'

Precursor Sequence:

TAAAAATAATTACTTGGTGGGGTGGGAGTGCACTGGAGGCAGCGGTTCATCGATCTGTTT
ATGAGATTTTGTTGTGAGTAAACACAGTTCATGAATCGGTCGATAAACCTCTGCATCCAG
CGCTCACTCTCCCATTCTTCTCTTTATTTATTTTTAATTTTTTGCTGGTAT

Genome Location:Chr6:22415276..22415256
Precursor Coordinates:101..272
MFE:-65.8
MFEI:0.97
GC:39.77
Plant Homologs:

aly-miR162b;aly-miR162a*;aly-miR162b*;aly-miR162a;ath-miR162a;ath-miR162b;ghr-miR162a;sly-miR162;vvi-miR162;cpa-miR162a;csi-miR162*;csi-miR162;gma-miR162;mtr-miR162;rco-miR162;zma-miR162;osa-miR162b;osa-miR162a;ptc-miR162b;ptc-miR162c;ptc-miR162a;sbi-miR162;

Structure:
Target:MDP0000076511 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGUUGUUUGGACAUGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000076511 
Target:MDP0000187512 
Target Start:1537 
Target End:1556 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AACUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000187512 
Target:MDP0000229637 
Target Start:1726 
Target End:1745 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AAUUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000229637 
Target:MDP0000868785 
Target Start:2719 
Target End:2738 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGCUGUUUGGAUGAGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000868785 
Target:MDP0000649405 
Target Start:60 
Target End:80 
miRNA Aligned Fragment:5'-GGAGGCAGCGGUUCAUCGAUC-3' 
Target Aligned Fragment:3'- CCUCCGUUGCCAAGUAACUCG -5' 
Inhibition Type:Cleavage 
MDP0000649405 
Target:MDP0000816713 
Target Start:850 
Target End:869 
miRNA Aligned Fragment:5'-GGAGGCAGCGGUUCAUCGAU-3' 
Target Aligned Fragment:3'- UCUCUGUCGUCAAGUAGUUU -5' 
Inhibition Type:Cleavage 
MDP0000816713 
Data resource:
Gleave, AP et al.
Huaping Yu et al.
microPC
microPC
mirNEST
mirNEST
PMRD
Varkonyi Gasic et al.
Wei et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested