AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR162b

miR162b  

Mature Sequence:5'-TCGATAAACCTCTGCATCCAG-3'

Precursor Sequence:

CTGGAGGCAGCGGTTCATCGATCTGTTTATGAGATTTTGTTGTGAGTAAACACAGTTCAT
GAATCGGTCGATAAACCTCTGCATCCAG

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000076511 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGUUGUUUGGACAUGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000076511 
Target:MDP0000187512 
Target Start:1537 
Target End:1556 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AACUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000187512 
Target:MDP0000229637 
Target Start:1726 
Target End:1745 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AAUUAUUUUGAGACGUAGGU -5' 
Inhibition Type:Translation 
MDP0000229637 
Target:MDP0000868785 
Target Start:2719 
Target End:2738 
miRNA Aligned Fragment:5'-UCGAUAAACCUCUGCAUCCA-3' 
Target Aligned Fragment:3'- AGCUGUUUGGAUGAGUAGGU -5' 
Inhibition Type:Cleavage 
MDP0000868785 
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested