AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR164a

miR164a  

Mature Sequence:5'-TGGAGAAGCAGGGCACGTGCA-3'

Precursor Sequence:

ATGGGTGAGTAGTTCGTGTTGGAGAAGCAGGGCACGTGCAAATTCTAGCTCGAGCAATCC
TTCATCAGGAGCTTAAAAACTTTGCACTTGCTCYCCTTCTCCAACACAAGCTTCTCACCT
CTTTTTCTTCCTCGCCCCATTTCTGCATCATCAGCTCGATCAACAAGGCAG

Genome Location:Chr3:32501177..32501157
Precursor Coordinates:181..352
MFE:-60.56
MFEI:0.74
GC:47.95
Plant Homologs:

aly-miR164b;aly-miR164a;aly-miR164c;ath-miR164b;ath-miR164a;ath-miR164c;bna-miR164;far-miR164b;far-miR164a;ghr-miR164;tae-miR164;vvi-miR164d;vvi-miR164b;vvi-miR164c;vvi-miR164a;csi-miR164;gma-miR164;mtr-miR164d;mtr-miR164b;mtr-miR164a;mtr-miR164c;rco-miR164a;rco-miR164c;rco-miR164d;rco-miR164b;zma-miR164a;zma-miR164c;zma-miR164f;zma-miR164h;zma-miR164b;zma-miR164g;zma-miR164e;zma-miR164d;bra-miR164a;ctr-miR164;osa-miR164c;osa-miR164b;osa-miR164f;osa-miR164a;osa-miR164e;osa-miR164d;ptc-miR164f;ptc-miR164d;ptc-miR164e;ptc-miR164b;ptc-miR164c;ptc-miR164a;sbi-miR164b;sbi-miR164;sbi-miR164d;sbi-miR164e;sbi-miR164c;

Structure:
Target:MDP0000310981 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACG -5' 
Inhibition Type:Cleavage 
MDP0000310981 
Target:MDP0000911724 
Target Start:645 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUU -5' 
Inhibition Type:Cleavage 
MDP0000911724 
Target:MDP0000121265 
Target Start:645 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUU -5' 
Inhibition Type:Cleavage 
MDP0000121265 
Target:MDP0000298182 
Target Start:618 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACG -5' 
Inhibition Type:Cleavage 
MDP0000298182 
Target:MDP0000528658 
Target Start:528 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACG -5' 
Inhibition Type:Cleavage 
MDP0000528658 
Target:MDP0000269941 
Target Start:24 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGCA-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUUCACGU -5' 
Inhibition Type:Cleavage 
MDP0000269941 
Target:MDP0000129335 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GUCUUUUCGUCCUGUGCACU -5' 
Inhibition Type:Cleavage 
MDP0000129335 
Target:MDP0000232050 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GUCUUUUCGUCCUGUGCACU -5' 
Inhibition Type:Cleavage 
MDP0000232050 
Target:MDP0000271887 
Target Start:95 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACG -5' 
Inhibition Type:Cleavage 
MDP0000271887 
Target:MDP0000276765 
Target Start:648 
Target End:667 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- GCCUCUUCGUGCUGUGCACU -5' 
Inhibition Type:Translation 
MDP0000276765 
Target:MDP0000231813 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUCUACU -5' 
Inhibition Type:Cleavage 
MDP0000231813 
Target:MDP0000283465 
Target Start:2739 
Target End:2759 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACGUGCA-3' 
Target Aligned Fragment:3'- ACCUCUUGGUCCCGUAAACGU -5' 
Inhibition Type:Cleavage 
MDP0000283465 
Target:MDP0000528658 
Target Start:527 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000528658 
Target:MDP0000298182 
Target Start:617 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000298182 
Target:MDP0000310981 
Target Start:797 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACGA -5' 
Inhibition Type:Cleavage 
MDP0000310981 
Target:MDP0000160621 
Target Start:359 
Target End:379 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000160621 
Target:MDP0000911724 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000911724 
Target:MDP0000121265 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000121265 
Target:MDP0000283465 
Target Start:2740 
Target End:2759 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACCUCUUGGUCCCGUAAACG -5' 
Inhibition Type:Cleavage 
MDP0000283465 
Target:MDP0000349606 
Target Start:24 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCCGAGRCCGA -5' 
Inhibition Type:Cleavage 
MDP0000349606 
Target:MDP0000179295 
Target Start:703 
Target End:723 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUUUUCCUUACGUGAACGA -5' 
Inhibition Type:Translation 
MDP0000179295 
Target:MDP0000303642 
Target Start:880 
Target End:900 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- ACCUUUUCCUUACGUGAACGA -5' 
Inhibition Type:Translation 
MDP0000303642 
Target:MDP0000258463 
Target Start:1226 
Target End:1246 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000258463 
Target:MDP0000139824 
Target Start:1325 
Target End:1345 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCGUUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000139824 
Target:MDP0000294776 
Target Start:469 
Target End:488 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUCGAUG -5' 
Inhibition Type:Cleavage 
MDP0000294776 
Target:MDP0000319220 
Target Start:469 
Target End:488 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUCGAUG -5' 
Inhibition Type:Cleavage 
MDP0000319220 
Target:MDP0000271887 
Target Start:94 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACUUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000271887 
Data resource:
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested