AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR164f

miR164f  

Mature Sequence:5'-TGGAGAAGCAGGGCACATGCT-3'

Precursor Sequence:

TAGGGAGAATGAGCCATGCTGGAGAAGCAGGGCACATGCTAGATATATCAGCATTGTCTG
AGAATTTCGCATGTGCTCTAGCTTTCCATCTTGGACTCTCTCCCTTTCAGGCACAAAGTT
GGCAGCAATGAAGGTGGTCAGTTTTTTCGGAGCTTACATTTTAACTTGTTT

Genome Location:Chr9:17740842..17740822
Precursor Coordinates:181..352
MFE:-61.2
MFEI:0.81
GC:44.44
Plant Homologs:

vvi-miR164b;mtr-miR164d;rco-miR164d;ptc-miR164f;

Structure:
Target:MDP0000528658 
Target Start:527 
Target End:547 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000528658 
Target:MDP0000298182 
Target Start:617 
Target End:637 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGAACGA -5' 
Inhibition Type:Cleavage 
MDP0000298182 
Target:MDP0000310981 
Target Start:797 
Target End:817 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCCUGUGCACGA -5' 
Inhibition Type:Cleavage 
MDP0000310981 
Target:MDP0000271887 
Target Start:94 
Target End:114 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUGUACGG -5' 
Inhibition Type:Cleavage 
MDP0000271887 
Target:MDP0000911724 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000911724 
Target:MDP0000121265 
Target Start:644 
Target End:664 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCCCGUGCAUUA -5' 
Inhibition Type:Cleavage 
MDP0000121265 
Target:MDP0000231813 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUCGUCUCGUCUACU -5' 
Inhibition Type:Cleavage 
MDP0000231813 
Target:MDP0000289153 
Target Start:76 
Target End:96 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCCUGUGUGG -5' 
Inhibition Type:Cleavage 
MDP0000289153 
Target:MDP0000166902 
Target Start:7 
Target End:27 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGA -5' 
Inhibition Type:Cleavage 
MDP0000166902 
Target:MDP0000481317 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
MDP0000481317 
Target:MDP0000384344 
Target Start:132 
Target End:151 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
MDP0000384344 
Target:MDP0000198995 
Target Start:264 
Target End:283 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACCUCUUUGUCUCGUCUACA -5' 
Inhibition Type:Cleavage 
MDP0000198995 
Target:MDP0000750318 
Target Start:16 
Target End:36 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGG -5' 
Inhibition Type:Cleavage 
MDP0000750318 
Target:MDP0000135060 
Target Start:379 
Target End:399 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGCU-3' 
Target Aligned Fragment:3'- GCCUCUUCGUCUCAUUUACGG -5' 
Inhibition Type:Cleavage 
MDP0000135060 
Target:MDP0000269941 
Target Start:25 
Target End:44 
miRNA Aligned Fragment:5'-UGGAGAAGCAGGGCACAUGC-3' 
Target Aligned Fragment:3'- ACUUCUUCGUCUCGUUCACG -5' 
Inhibition Type:Cleavage 
MDP0000269941 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested