AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR166a

miR166a  

Mature Sequence:5'-GGAATGTTGTCTGGCTCGAGG-3'

Precursor Sequence:

CTAGGGTTTCGAAGATGTTGAAGGAGAAGAGGAGCTTTAGCTTTTGAGGGGAATGTTGTC
TGGCTCGAGGACACTTTCCTTGATCTATAATCTCTAGATCAACCGTTATATACCTATACA
TATATCTATATATGTGTTTGTATATGTTGTGTGTATCATCTGCATACATAGATGATCAGG
TTAAGTAGTGTCGTCGGACCAGGCTTCATTCCCCCCAATTC

Genome Location:Chr1:28491599..28491619
Precursor Coordinates:7..228
MFE:-83.15
MFEI:0.93
GC:40.27
Plant Homologs:

aly-miR166d*;aly-miR166b*;aly-miR166c*;aly-miR166e*;aly-miR166a*;csi-miR166e*;zma-miR166c*;zma-miR166k*;zma-miR166n*;zma-miR166a*;

Structure:
Target:MDP0000251484 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000005879 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000005879 
Target:MDP0000242861 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2700 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Translation 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000251484 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000005879 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000005879 
Target:MDP0000242861 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2698 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGGUG -5' 
Inhibition Type:Translation 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Data resource:
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested