AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR166e

miR166e  

Mature Sequence:5'-CTCGGACCAGGCTTCATTCCC-3'

Precursor Sequence:

CTCTTAAGAACAGTTGTGGGGAATGTTGTCTGGTTCGAGATCTTTCAATAAAACTTGAAG
ATCGTTATCATCTGAATGATCTCGGACCAGGCTTCATTCCCCTCAACTTGGAGGAATATA
CAGAGTCTAGAAACATATCATGCATTAAAATGCAACGAAGAATTATACAGG

Genome Location:Chr1:28491598..28491618
Precursor Coordinates:181..352
MFE:-57.09
MFEI:0.87
GC:38.6
Plant Homologs:

aly-miR166d*;aly-miR166c*;aly-miR166e*;aly-miR166a*;aly-miR165a*;csi-miR166e*;zma-miR166c*;zma-miR166a*;zma-miR166d*;zma-miR166b*;zma-miR166g*;

Structure:
Target:MDP0000251484 
Target Start:607 
Target End:626 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:553 
Target End:572 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000242861 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:562 
Target End:581 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:589 
Target End:608 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:589 
Target End:608 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:568 
Target End:587 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGCCUGGUCCGAAGUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2700 
Target End:2720 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Cleavage 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:423 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GAGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000161945 
Target Start:236 
Target End:255 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAACCUGGUUCGAAGUAAGA -5' 
Inhibition Type:Cleavage 
MDP0000161945 
Target:MDP0000774802 
Target Start:7 
Target End:26 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAGUUUGGUCAGAGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000774802 
Target:MDP0000301081 
Target Start:1318 
Target End:1337 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GGGCCUGGUUUGAACUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000301081 
Target:MDP0000305463 
Target Start:380 
Target End:399 
miRNA Aligned Fragment:5'-CUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- GAGCUUGGACAGAAGUAAGG -5' 
Inhibition Type:Translation 
MDP0000305463 
Target:MDP0000238967 
Target Start:1833 
Target End:1853 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UUUUACAACGGACCGAACUCC -5' 
Inhibition Type:Cleavage 
MDP0000238967 
Target:MDP0000279466 
Target Start:51 
Target End:71 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UCUUACAGCAGGCUGGGCUUU -5' 
Inhibition Type:Cleavage 
MDP0000279466 
Target:MDP0000453068 
Target Start:51 
Target End:71 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UCUUACAGCAGGCUGGGCUUU -5' 
Inhibition Type:Cleavage 
MDP0000453068 
Target:MDP0000307668 
Target Start:1752 
Target End:1772 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UUUUACAACGGGCCGAACUCC -5' 
Inhibition Type:Cleavage 
MDP0000307668 
Target:MDP0000292188 
Target Start:1752 
Target End:1772 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UUUUACAACGGGCCGAACUCC -5' 
Inhibition Type:Cleavage 
MDP0000292188 
Target:MDP0000161712 
Target Start:895 
Target End:914 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- UUUUAUGGCAGACCGAGUUC -5' 
Inhibition Type:Cleavage 
MDP0000161712 
Target:MDP0000247776 
Target Start:1012 
Target End:1031 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- UUUUAUGGCAGACCGAGUUC -5' 
Inhibition Type:Cleavage 
MDP0000247776 
Target:MDP0000280476 
Target Start:1743 
Target End:1763 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAGG-3' 
Target Aligned Fragment:3'- UCUUACAAAGGACCGAACUCC -5' 
Inhibition Type:Translation 
MDP0000280476 
Target:MDP0000288921 
Target Start:423 
Target End:442 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- CUUUACAACCGGUUGAGCUC -5' 
Inhibition Type:Translation 
MDP0000288921 
Target:MDP0000271818 
Target Start:423 
Target End:442 
miRNA Aligned Fragment:5'-GGAAUGUUGUCUGGCUCGAG-3' 
Target Aligned Fragment:3'- CUUUACAACCGGUUGAGCUC -5' 
Inhibition Type:Translation 
MDP0000271818 
Data resource:
Wei et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested