AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR166f

miR166f  

Mature Sequence:5'-TCTCGGACCAGGCTTCATTCC-3'

Precursor Sequence:

_

Genome Location:Chr10:19531934..19531954
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000231542 
Target Start:405 
Target End:424 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGAGUCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Target:MDP0000301081 
Target Start:1318 
Target End:1338 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGGGCCUGGUUUGAACUAAGG -5' 
Inhibition Type:Cleavage 
MDP0000301081 
Target:MDP0000305463 
Target Start:380 
Target End:400 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUCC-3' 
Target Aligned Fragment:3'- AGAGCUUGGACAGAAGUAAGG -5' 
Inhibition Type:Translation 
MDP0000305463 
Target:MDP0000161945 
Target Start:237 
Target End:256 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- UGAACCUGGUUCGAAGUAAG -5' 
Inhibition Type:Cleavage 
MDP0000161945 
Target:MDP0000133490 
Target Start:237 
Target End:256 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- UGAACCUGGUUCGAAGUAAG -5' 
Inhibition Type:Cleavage 
MDP0000133490 
Target:MDP0000177486 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGUGCCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
MDP0000177486 
Target:MDP0000144105 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UCUCGGACCAGGCUUCAUUC-3' 
Target Aligned Fragment:3'- AGUGCCUGGUUUGAAGUAGG -5' 
Inhibition Type:Cleavage 
MDP0000144105 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested