AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR166h

miR166h  

Mature Sequence:5'-TCGGACCAGGCTTCATTCCCC-3'

Precursor Sequence:

TGAGGGGAATGTTGTCTGGCTCGAGGACACTTTCCTTGATCTATAATCTCTAGATCAACC
GTTATATACCTATACATATATCTATATATGTGTTTGTATATGTTGTGTGTATCATCTGCA
TACATAGATGATCAGGTTAAGTAGTGTCGTCGGACCAGGCTTCATTCCCCCCAATTCATG
GCTTCCGATCCACACGGAGACCTTTTTTCCAGGGCAGATGG

Genome Location:Chr1:28491599..28491618
Precursor Coordinates:471..692
MFE:-82.5
MFEI:0.88
GC:42.53
Plant Homologs:

aly-miR166g;aly-miR166g;aly-miR166c;aly-miR166c;aly-miR166b;aly-miR166b;aly-miR166d*;aly-miR166d*;aly-miR166e;aly-miR166e;aly-miR166b*;aly-miR165b;aly-miR165b;aly-miR166a;aly-miR166a;aly-miR166c*;aly-miR166c*;aly-miR166e*;aly-miR166e*;aly-miR166a*;aly-miR166a*;aly-miR165a*;aly-miR165a*;aly-miR166f;aly-miR166f;aly-miR166d;aly-miR166d;aly-miR165a;aly-miR165a;ath-miR165a;ath-miR165a;ath-miR166d;ath-miR166d;ath-miR166b;ath-miR166b;ath-miR166f;ath-miR166f;ath-miR166a;ath-miR166a;ath-miR166g;ath-miR166g;ath-miR166c;ath-miR166c;ath-miR166e;ath-miR166e;ath-miR165b;ath-miR165b;bna-miR166a;bna-miR166a;bna-miR166d;bna-miR166d;bna-miR166b;bna-miR166b;bna-miR166c;bna-miR166c;crt-miR166a;crt-miR166a;crt-miR166b;crt-miR166b;far-miR166;far-miR166;ghr-miR166b;ghr-miR166b;ppt-miR166d;ppt-miR166d;ppt-miR166k;ppt-miR166k;ppt-miR166i;ppt-miR166i;ppt-miR166a;ppt-miR166a;ppt-miR166b;ppt-miR166b;ppt-miR166h;ppt-miR166h;ppt-miR166l;ppt-miR166l;ppt-miR166c;ppt-miR166c;ppt-miR166f;ppt-miR166f;ppt-miR166g;ppt-miR166g;ppt-miR166e;ppt-miR166e;ppt-miR166j;ppt-miR166j;pvu-miR166a;pvu-miR166a;sly-miR166a;sly-miR166a;sly-miR166b;sly-miR166b;vvi-miR166d;vvi-miR166d;vvi-miR166f;vvi-miR166f;vvi-miR166b;vvi-miR166b;vvi-miR166e;vvi-miR166e;vvi-miR166g;vvi-miR166g;vvi-miR166c;vvi-miR166c;vvi-miR166h;vvi-miR166h;vvi-miR166a;vvi-miR166a;aqc-miR166d;aqc-miR166d;aqc-miR166c;aqc-miR166c;aqc-miR166b;aqc-miR166b;aqc-miR166e;aqc-miR166e;aqc-miR166a;aqc-miR166a;csi-miR166e;csi-miR166e;csi-miR166c;csi-miR166c;csi-miR166a;csi-miR166a;csi-miR166b;csi-miR166b;csi-miR166d;csi-miR166d;csi-miR166e*;csi-miR166e*;gma-miR166b;gma-miR166b;gma-miR166a;gma-miR166a;hvu-miR166;hvu-miR166;hvu-miR166b;hvu-miR166b;mtr-miR166e;mtr-miR166e;mtr-miR166f;mtr-miR166f;mtr-miR166g;mtr-miR166g;mtr-miR166c;mtr-miR166c;mtr-miR166h;mtr-miR166h;mtr-miR166;mtr-miR166;mtr-miR166b;mtr-miR166b;pab-miR166a;pab-miR166a;pab-miR166b;pab-miR166b;pta-miR166b;pta-miR166b;pta-miR166a;pta-miR166a;pta-miR166c;pta-miR166c;rco-miR166d;rco-miR166d;rco-miR166a;rco-miR166a;rco-miR166c;rco-miR166c;rco-miR166b;rco-miR166b;rco-miR166e;rco-miR166e;smo-miR166c;smo-miR166c;smo-miR166a;smo-miR166a;smo-miR166b;smo-miR166b;zma-miR166a;zma-miR166a;zma-miR166c*;zma-miR166c*;zma-miR166n;zma-miR166n;zma-miR166h;zma-miR166h;zma-miR166j;zma-miR166j;zma-miR166k*;zma-miR166e;zma-miR166e;zma-miR166m;zma-miR166m;zma-miR166n*;zma-miR166a*;zma-miR166a*;zma-miR166i;zma-miR166i;zma-miR166d;zma-miR166d;zma-miR166f;zma-miR166f;zma-miR166d*;zma-miR166d*;zma-miR166b*;zma-miR166b*;zma-miR166c;zma-miR166c;zma-miR166l;zma-miR166l;zma-miR166g*;zma-miR166g*;zma-miR166g;zma-miR166g;zma-miR166k;zma-miR166k;zma-miR166b;zma-miR166b;bdi-miR166;bdi-miR166;ctr-miR166;ctr-miR166;osa-miR166h;osa-miR166h;osa-miR166b;osa-miR166b;osa-miR166l;osa-miR166l;osa-miR166k;osa-miR166k;osa-miR166f;osa-miR166f;osa-miR166n;osa-miR166n;osa-miR166j;osa-miR166j;osa-miR166c;osa-miR166c;osa-miR166d;osa-miR166d;osa-miR166g;osa-miR166g;osa-miR166a;osa-miR166a;osa-miR166m;osa-miR166m;osa-miR166i;osa-miR166i;osa-miR166e;osa-miR166e;ptc-miR166b;ptc-miR166b;ptc-miR166i;ptc-miR166i;ptc-miR166p;ptc-miR166p;ptc-miR166l;ptc-miR166l;ptc-miR166k;ptc-miR166k;ptc-miR166d;ptc-miR166d;ptc-miR166f;ptc-miR166f;ptc-miR166n;ptc-miR166n;ptc-miR166c;ptc-miR166c;ptc-miR166o;ptc-miR166o;ptc-miR166j;ptc-miR166j;ptc-miR166h;ptc-miR166h;ptc-miR166a;ptc-miR166a;ptc-miR166m;ptc-miR166m;ptc-miR166q;ptc-miR166q;ptc-miR166e;ptc-miR166e;ptc-miR166g;ptc-miR166g;sbi-miR166i;sbi-miR166i;sbi-miR166b;sbi-miR166b;sbi-miR166e;sbi-miR166e;sbi-miR166c;sbi-miR166c;sbi-miR166g;sbi-miR166g;sbi-miR166j;sbi-miR166j;sbi-miR166h;sbi-miR166h;sbi-miR166d;sbi-miR166d;sbi-miR166f;sbi-miR166f;sbi-miR166k;sbi-miR166k;sbi-miR166a;sbi-miR166a;

Structure:
Target:MDP0000251484 
Target Start:606 
Target End:625 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000251484 
Target:MDP0000313059 
Target Start:552 
Target End:571 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000313059 
Target:MDP0000426630 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000426630 
Target:MDP0000005879 
Target Start:531 
Target End:550 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000005879 
Target:MDP0000242861 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000242861 
Target:MDP0000236500 
Target Start:561 
Target End:580 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000236500 
Target:MDP0000050082 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000050082 
Target:MDP0000943529 
Target Start:588 
Target End:607 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000943529 
Target:MDP0000126553 
Target Start:567 
Target End:586 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCGAAGUAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000126553 
Target:MDP0000142085 
Target Start:2700 
Target End:2719 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- GGCCUGGUCCUGGGUAGGGG -5' 
Inhibition Type:Translation 
MDP0000142085 
Target:MDP0000231542 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-UCGGACCAGGCUUCAUUCCC-3' 
Target Aligned Fragment:3'- AGUCUGGUUUGAAGUAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000231542 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested