AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR167a

miR167a  

Mature Sequence:5'-TGAAGCTGCCAGCATGATCTAA-3'

Precursor Sequence:

ATCGTGCACCTCCAATAGTTGAAGCTGCCAGCATGATCTAAGCTTTCTTTGTACATAGGA
CAGGCTAGATCATGTGGTCGCTTCACCTGTTGAATGAAGCACGAGAAAACCCTAGATTCA
CAGCCATCGACCTCCTCAAGAACCCATTAGGGTTTTTTTTTTTTTTTTCGGA

Genome Location:Chr3:29445473..29445453
Precursor Coordinates:181..353
MFE:-58.8
MFEI:0.78
GC:43.6
Plant Homologs:

bna-miR167b;bna-miR167a;

Structure:
Target:MDP0000296582 
Target Start:1092 
Target End:1111 
miRNA Aligned Fragment:5'-UGAAGCUGCCAGCAUGAUCU-3' 
Target Aligned Fragment:3'- ACUUUGAUUGUCGUACUCGA -5' 
Inhibition Type:Translation 
MDP0000296582 
Data resource:
Gleave, AP et al.
Huaping Yu et al.
microPC
mirNEST
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested