AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR167b*

miR167b*  

Mature Sequence:5'-GGTCATGCTCTGACAGCCTCACT-3'

Precursor Sequence:

_

Genome Location:Chr3:29445386..29445364
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000217490 
Target Start:2530 
Target End:2549 
miRNA Aligned Fragment:5'-GGUCAUGCUCUGACAGCCUC-3' 
Target Aligned Fragment:3'- CUGGUGUGAGACUGUCUGAG -5' 
Inhibition Type:Cleavage 
MDP0000217490 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested