AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR167f

miR167f  

Mature Sequence:5'-TGAAGCTGCCAGCATGATCTT-3'

Precursor Sequence:

ATCATGCACTGGTAGCAGTTGAAGCTGCCAGCATGATCTTATAACTCCCTACTTCGTTTA
GGGAAGCTCAGATCATCTGGCAGTTTCACCTGTTGTTGGTAGCATGAGACCATCAAAACC
CTAATTCCGACATAACACCAATCCCTAGCTACTGAAAATAAAACGGTATTA

Genome Location:Chr13:20542220..20542240
Precursor Coordinates:181..352
MFE:-60.2
MFEI:0.82
GC:42.69
Plant Homologs:

ahy-miR167-5p;ahy-miR167-3p;aly-miR167a;aly-miR167d;aly-miR167c;aly-miR167b;ath-miR167d;ath-miR167b;ath-miR167a;ath-miR167c;bna-miR167c;bna-miR167b;bna-miR167a;ccl-miR167b;ccl-miR167a;ghr-miR167;gso-miR167a;ppt-miR167;sly-miR167;tae-miR167;vvi-miR167d;vvi-miR167a;vvi-miR167e;vvi-miR167b;vvi-miR167c;aqc-miR167;csi-miR167b;csi-miR167c;csi-miR167a;gma-miR167b;gma-miR167e;gma-miR167d;gma-miR167a;gma-miR167g;gma-miR167c;gma-miR167f;mtr-miR167;rco-miR167c;rco-miR167a;rco-miR167b;zma-miR167i;zma-miR167f;zma-miR167h;zma-miR167e;zma-miR167d;zma-miR167a;zma-miR167g;zma-miR167b;zma-miR167c;zma-miR167j;bdi-miR167;bra-miR167b;bra-miR167d;bra-miR167c;bra-miR167a;ctr-miR167;lja-miR167;osa-miR167b;osa-miR167f;osa-miR167a;osa-miR167h;osa-miR167d;osa-miR167i;osa-miR167e;osa-miR167g;osa-miR167j;osa-miR167c;ptc-miR167d;ptc-miR167f;ptc-miR167e;ptc-miR167c;ptc-miR167g;ptc-miR167a;ptc-miR167b;sbi-miR167e;sbi-miR167b;sbi-miR167g;sbi-miR167i;sbi-miR167a;sbi-miR167c;sbi-miR167h;sbi-miR167d;sbi-miR167f;sof-miR167b;sof-miR167a;

Structure:
Target:MDP0000296582 
Target Start:1091 
Target End:1111 
miRNA Aligned Fragment:5'-UGAAGCUGCCAGCAUGAUCUU-3' 
Target Aligned Fragment:3'- ACUUUGAUUGUCGUACUCGAA -5' 
Inhibition Type:Translation 
MDP0000296582 
Target:MDP0000283804 
Target Start:205 
Target End:226 
miRNA Aligned Fragment:5'-UGAAGCUGCCA-GCAUGAUCUU-3' 
Target Aligned Fragment:3'- ACUUCGACUGUCCGUACUAGGA -5' 
Inhibition Type:Translation 
MDP0000283804 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested