AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR169g

miR169g  

Mature Sequence:5'-TAGCCAAGGATGACTTGCCTGC-3'

Precursor Sequence:

_

Genome Location:Chr9:454101..454080
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000183865 
Target Start:437 
Target End:457 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000183865 
Target:MDP0000164531 
Target Start:914 
Target End:934 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000164531 
Target:MDP0000279028 
Target Start:962 
Target End:982 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
MDP0000279028 
Target:MDP0000885534 
Target Start:847 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUGC-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGAAG -5' 
Inhibition Type:Translation 
MDP0000885534 
Target:MDP0000263881 
Target Start:1618 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUGC-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGAAG -5' 
Inhibition Type:Translation 
MDP0000263881 
Target:MDP0000314593 
Target Start:666 
Target End:686 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCUG-3' 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
MDP0000314593 
Target:MDP0000375005 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
MDP0000375005 
Target:MDP0000146933 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000146933 
Target:MDP0000296077 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
MDP0000296077 
Target:MDP0000778477 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
MDP0000778477 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested