AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:





Precursor Sequence:


Genome Location:Chr9:454101..454081
Precursor Coordinates:180..351
Plant Homologs:


Target Start:437 
Target End:457 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:914 
Target End:934 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:962 
Target End:982 
Target Aligned Fragment:3'- UUCGGUUCUUACUAAACGGAC -5' 
Inhibition Type:Cleavage 
Target Start:666 
Target End:686 
Target Aligned Fragment:3'- UUCGGUUCUUACUCAACGGMC -5' 
Inhibition Type:Cleavage 
Target Start:849 
Target End:868 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
Target Start:1620 
Target End:1639 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUUGGUUUCAACUGAACGGA -5' 
Inhibition Type:Translation 
Target Start:875 
Target End:894 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- CUCGGUUCCUACUUAACGGU -5' 
Inhibition Type:Cleavage 
Target Start:1359 
Target End:1378 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:1632 
Target End:1651 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- GUCGGUUCUUACUUAACGGC -5' 
Inhibition Type:Cleavage 
Target Start:309 
Target End:328 
miRNA Aligned Fragment:5'-UAGCCAAGGAUGACUUGCCU-3' 
Target Aligned Fragment:3'- AUCGGUACCUAUUGUACGGA -5' 
Inhibition Type:Cleavage 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested