AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR171a

miR171a  

Mature Sequence:5'-TGATTGAGCCGCGCCAATATC-3'

Precursor Sequence:

GCAGGAAAAATATAGTGATTTGCGTATATATAATTACCTTATTGAAATAGTTACTGTGAT
GTTGGCCCGGTTTCACTCAGAGAGGAAGACTGCTTACTGCTGCATCTGCATGTACGTAGG
AACGTACGTTGTGGTTGGTCTCCTGAATCTGATTGAGCCGCGCCAATATCTCAGTGCTCT
TTCATCCTCTCACGTCGGCTGCCTCCGCCTCCTTCCTTGCT

Genome Location:Chr5:3173684..3173704
Precursor Coordinates:48..269
MFE:-78.5
MFEI:0.76
GC:46.61
Plant Homologs:

aly-miR171a;ath-miR171a;bna-miR171g;bna-miR171f;ccl-miR171;ppt-miR171b;ppt-miR171a;sly-miR171d;vvi-miR171h;vvi-miR171b;vvi-miR171f;vvi-miR171e;csi-miR171a;mtr-miR171b;mtr-miR171e;rco-miR171g;smo-miR171c;smo-miR171d;zma-miR171m;zma-miR171a;zma-miR171l;zma-miR171n;bdi-miR171a;bdi-miR171d;bra-miR171e;osa-miR171a;osa-miR171i;ptc-miR171k;ptc-miR171d;ptc-miR171j;ptc-miR171c;sbi-miR171h;sbi-miR171g;sbi-miR171j;

Structure:
Target:MDP0000784909 
Target Start:1227 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1356 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1380 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1908 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUC-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000302855 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
MDP0000302855 
Target:MDP0000784909 
Target Start:1228 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1357 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1381 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1909 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUA -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000302855 
Target Start:892 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUA -5' 
Inhibition Type:Translation 
MDP0000302855 
Data resource:
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested