AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR171c

miR171c  

Mature Sequence:5'-TTGAGCCGTGCCAATATCACG-3'

Precursor Sequence:

AGCCAAAGAAAGAGATGGATTGGGATCAGTTTGAACGGGATATTGGTCCGGTTCAATAAG
AAAACAGTGCTCTCAAAGTGCTTGAGCTCGGCTTTTTGATTGAGCCGTGCCAATATCACG
TGTCACTGTTCCTCTTATCATATATCCCACCCTTTGCTCTATTCCAATTCA

Genome Location:Chr9:7273898..7273878
Precursor Coordinates:101..272
MFE:-54.86
MFEI:0.74
GC:43.27
Plant Homologs:

aly-miR171b;aly-miR170;aly-miR171c;ath-miR171c;ath-miR170;ath-miR171b;bna-miR171b;bna-miR171e;bna-miR171c;bna-miR171a;bna-miR171d;crt-miR171;far-miR171;sly-miR171b;sly-miR171a;tae-miR171b;tae-miR171a;vvi-miR171a;vvi-miR171c;vvi-miR171d;vvi-miR171i;aqc-miR171d;aqc-miR171b;aqc-miR171f;aqc-miR171a;bol-miR171a;gma-miR171a;hvu-miR171;mtr-miR171;mtr-miR171c;mtr-miR171d;mtr-miR171f;mtr-miR171g;rco-miR171c;rco-miR171b;rco-miR171a;rco-miR171d;rco-miR171e;rco-miR171f;smo-miR171b;smo-miR171a;zma-miR171i;zma-miR171e;zma-miR171d;zma-miR171f;zma-miR171c;zma-miR171j;zma-miR171b;bdi-miR171c;bra-miR171d;bra-miR171c;bra-miR171b;bra-miR171a;osa-miR171d;osa-miR171e;osa-miR171c;osa-miR171f;osa-miR171b;ptc-miR171a;ptc-miR171i;ptc-miR171b;ptc-miR171h;ptc-miR171e;ptc-miR171f;ptc-miR171g;sbi-miR171k;sbi-miR171a;sbi-miR171i;sbi-miR171b;sbi-miR171d;

Structure:
Target:MDP0000784909 
Target Start:1225 
Target End:1244 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1354 
Target End:1373 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1378 
Target End:1397 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1906 
Target End:1925 
miRNA Aligned Fragment:5'-UUGAGCCGUGCCAAUAUCAC-3' 
Target Aligned Fragment:3'- AACUCGGCGCGGUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested