AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR171f

miR171f  

Mature Sequence:5'-ATGAGCCGAACCAATATCACT-3'

Precursor Sequence:

TGTGATATTGGTTTTGGCTCATATCTCTGATAATTAGCTTATCTTCGATCATAAATCGTC
ATGATGCACAACAAAGACTAGTACTACGTACTCTTTGAGATGAGCCGAACCAATATCACT
CTTGTATGCTTCTTTGCATATATATATTTGCCTACCTAGCGTGGTCGTTTG

Genome Location:Chr1:28395691..28395671
Precursor Coordinates:101..272
MFE:-50.7
MFEI:0.79
GC:37.43
Plant Homologs:

vvi-miR171g;zma-miR171h;zma-miR171k;osa-miR171h;sbi-miR171e;sbi-miR171f;

Structure:
Target:MDP0000708927 
Target Start:577 
Target End:597 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCACU-3' 
Target Aligned Fragment:3'- GGCUCGGUUUGGUUAGAGUGG -5' 
Inhibition Type:Cleavage 
MDP0000708927 
Target:MDP0000153068 
Target Start:1298 
Target End:1318 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCACU-3' 
Target Aligned Fragment:3'- UACUUGGUUUGGUUUUCGUGG -5' 
Inhibition Type:Cleavage 
MDP0000153068 
Target:MDP0000285731 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-AUGAGCCGAACCAAUAUCAC-3' 
Target Aligned Fragment:3'- GACUCGGCUUGUUUAUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000285731 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested