AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR171g

miR171g  

Mature Sequence:5'-TGATTGAGCCGCGCCAATATCT-3'

Precursor Sequence:

_

Genome Location:Chr12:20831884..20831905
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000784909 
Target Start:1226 
Target End:1247 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000784909 
Target:MDP0000275704 
Target Start:1355 
Target End:1376 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000275704 
Target:MDP0000151144 
Target Start:1379 
Target End:1400 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000151144 
Target:MDP0000274120 
Target Start:1907 
Target End:1928 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- ACUAACUCGGCGCGGUUAUAGG -5' 
Inhibition Type:Cleavage 
MDP0000274120 
Target:MDP0000302855 
Target Start:890 
Target End:911 
miRNA Aligned Fragment:5'-UGAUUGAGCCGCGCCAAUAUCU-3' 
Target Aligned Fragment:3'- AUUAACUCGCCGAGGUUAUACA -5' 
Inhibition Type:Translation 
MDP0000302855 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested