AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172a

miR172a  

Mature Sequence:5'-AGAATCTTGATGATGCTGCAT-3'

Precursor Sequence:

AATGCATGGAGGAAATGTATAGATTGACAGTCGTTGTTTGCGGGTGTGGCATCATCAAGA
TTCACACATGCAATTAACTGATAAAGTTGTTTGAAAGTGAGAATCTTGATGATGCTGCAT
CGGCAATAAACCACTATACAAAAGAGAGGAGAACTCCACAGTCAGTTTCAC

Genome Location:Chr1:17970805..17970824
Precursor Coordinates:101..272
MFE:-66.9
MFEI:0.98
GC:39.77
Plant Homologs:

aly-miR172a;aly-miR172d;aly-miR172a*;aly-miR172c;aly-miR172b;aly-miR172e;ath-miR172c;ath-miR172b;ath-miR172e;ath-miR172a;ath-miR172d;sly-miR172b;sly-miR172a;vvi-miR172d;aqc-miR172b;aqc-miR172a;bol-miR172b;bol-miR172a;csi-miR172a;csi-miR172b;gma-miR172f;gma-miR172b;gma-miR172a;zma-miR172d;zma-miR172a;zma-miR172e;zma-miR172b;zma-miR172c;ata-miR172;bra-miR172a;bra-miR172b;osa-miR172b;osa-miR172a;osa-miR1426;osa-miR172d;ptc-miR172a;ptc-miR172e;ptc-miR172c;ptc-miR172b;ptc-miR172f;ptc-miR172d;sbi-miR172d;sbi-miR172a;sbi-miR172c;

Structure:
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000148472 
Target Start:424 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000148472 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000422421 
Target Start:664 
Target End:683 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
MDP0000422421 
Target:MDP0000189383 
Target Start:853 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
MDP0000189383 
Target:MDP0000173178 
Target Start:853 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGU -5' 
Inhibition Type:Translation 
MDP0000173178 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000148472 
Target Start:424 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000148472 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000422421 
Target Start:663 
Target End:683 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
MDP0000422421 
Target:MDP0000173178 
Target Start:852 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
MDP0000173178 
Target:MDP0000189383 
Target Start:852 
Target End:872 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UCUUAGAGGUACUGCUACGUG -5' 
Inhibition Type:Translation 
MDP0000189383 
Target:MDP0000153001 
Target Start:1060 
Target End:1080 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UUUUAGAACUAGUAUGAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000153001 
Target:MDP0000233315 
Target Start:1570 
Target End:1590 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- UUUUAGAACUAGUAUGAGGUG -5' 
Inhibition Type:Cleavage 
MDP0000233315 
Target:MDP0000315449 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCACA-3' 
Target Aligned Fragment:3'- CACUUUAGUAGUUGUAAGUGU -5' 
Inhibition Type:Cleavage 
MDP0000315449 
Target:MDP0000187052 
Target Start:879 
Target End:899 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCACA-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCUAAAUUU -5' 
Inhibition Type:Cleavage 
MDP0000187052 
Target:MDP0000276570 
Target Start:1003 
Target End:1022 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCCAAGUU -5' 
Inhibition Type:Cleavage 
MDP0000276570 
Target:MDP0000257662 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000257662 
Target:MDP0000772107 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000772107 
Target:MDP0000293297 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000293297 
Target:MDP0000863027 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000863027 
Target:MDP0000498407 
Target Start:1564 
Target End:1583 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000498407 
Data resource:
Gleave, AP et al.
Huaping Yu et al.
mirNEST
Varkonyi Gasic et al.
Wei et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested