AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172a*

miR172a*  

Mature Sequence:5'-GTGGCATCATCAAGATTCACA-3'

Precursor Sequence:

AATGCATGGAGGAAATGTATAGATTGACAGTCGTTGTTTGCGGGTGTGGCATCATCAAGA
TTCACACATGCAATTAACTGATAAAGTTGTTTGAAAGTGAGAATCTTGATGATGCTGCAT
CGGCAATAAACCACTATACAAAAGAGAGGAGAACTCCACAGTCAGTTTCAC

Genome Location:Chr3:11199416..11199396
Precursor Coordinates:101..272
MFE:-66.9
MFEI:0.98
GC:39.77
Plant Homologs:

aly-miR172a;aly-miR172d;aly-miR172a*;aly-miR172c;aly-miR172b;ath-miR172c;ath-miR172b;ath-miR172a;ath-miR172d;sly-miR172b;sly-miR172a;vvi-miR172d;aqc-miR172a;bol-miR172b;bol-miR172a;csi-miR172a;csi-miR172b;gma-miR172f;gma-miR172b;gma-miR172a;zma-miR172d;zma-miR172a;zma-miR172b;zma-miR172c;ata-miR172;bra-miR172a;bra-miR172b;osa-miR172a;osa-miR1426;osa-miR172d;ptc-miR172a;ptc-miR172c;ptc-miR172b;ptc-miR172f;sbi-miR172d;sbi-miR172a;sbi-miR172c;

Structure:
Target:MDP0000315449 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCACA-3' 
Target Aligned Fragment:3'- CACUUUAGUAGUUGUAAGUGU -5' 
Inhibition Type:Cleavage 
MDP0000315449 
Target:MDP0000187052 
Target Start:879 
Target End:899 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCACA-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCUAAAUUU -5' 
Inhibition Type:Cleavage 
MDP0000187052 
Target:MDP0000276570 
Target Start:1003 
Target End:1022 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- CACCGUGGUAGUUCCAAGUU -5' 
Inhibition Type:Cleavage 
MDP0000276570 
Target:MDP0000257662 
Target Start:403 
Target End:422 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000257662 
Target:MDP0000772107 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000772107 
Target:MDP0000293297 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000293297 
Target:MDP0000863027 
Target Start:415 
Target End:434 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000863027 
Target:MDP0000498407 
Target Start:1564 
Target End:1583 
miRNA Aligned Fragment:5'-GUGGCAUCAUCAAGAUUCAC-3' 
Target Aligned Fragment:3'- UAUCGUAGUAAUUCUAGGUG -5' 
Inhibition Type:Translation 
MDP0000498407 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested