AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172b

miR172b  

Mature Sequence:5'-GGAATCTTGATGATGCTGCAT-3'

Precursor Sequence:

GAGTAAGTCAGTATTCGCGGGTGCAGCATCATCAAGATTCACATACAGGCAAGGGGGCTA
CCTTTATCGATCGAGTAAATTGTTACCGCACCAATAAGAATATTTCCTTCAACTTCCTTT
TGTACTTGAAAGGTAGTTCCTTCGAAGTGGGAATCTTGATGATGCTGCATCAGCTGGTAC
ATGACTATTTGGAATCTGCGTCGATGATCCCTGTGAAGAAG

Genome Location:Chr3:7639596..7639577
Precursor Coordinates:51..272
MFE:-79
MFEI:0.82
GC:43.44
Plant Homologs:

aly-miR172a;aly-miR172c*;aly-miR172a*;aly-miR172b;aly-miR172b*;aly-miR172e;ath-miR172b;ath-miR172e;ath-miR172a;sly-miR172b;sly-miR172a;vvi-miR172c;vvi-miR172d;aqc-miR172b;aqc-miR172a;bol-miR172b;bol-miR172a;csi-miR172c;gma-miR172e;gma-miR172d;gma-miR172b;gma-miR172c;gma-miR172a;rco-miR172;zma-miR172e;zma-miR172b*;zma-miR172d*;ata-miR172;bra-miR172a;bra-miR172b;osa-miR172b;osa-miR172a;osa-miR172d;ptc-miR172a;ptc-miR172g;ptc-miR172e;ptc-miR172c;ptc-miR172b;ptc-miR172h;ptc-miR172f;ptc-miR172d;sbi-miR172b;

Structure:
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000302021 
Target Start:516 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGU -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000506954 
Target Start:263 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
MDP0000506954 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000138865 
Target Start:863 
Target End:882 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGU -5' 
Inhibition Type:Translation 
MDP0000138865 
Target:MDP0000123673 
Target Start:956 
Target End:975 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGU -5' 
Inhibition Type:Translation 
MDP0000123673 
Target:MDP0000285150 
Target Start:888 
Target End:907 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000378930 
Target Start:3402 
Target End:3421 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGAGGAAUUACGACGU -5' 
Inhibition Type:Translation 
MDP0000378930 
Target:MDP0000311595 
Target Start:1574 
Target End:1593 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
MDP0000311595 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested