AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172c

miR172c  

Mature Sequence:5'-AGAATCTTGATGATGCTGCAG-3'

Precursor Sequence:

AAATGCATGGAGGAAATGTATAGATTGACAGTCGTTGTTTGCGGGTGTGGCATCATCAAG
ATTCACACATGCAATTAACTGATAAAGTTGTTTGAAAGTGAGAATCTTGATGATGCTGCA
TCGGCAATAAACCACTATACAAAAGAGAGGAGAACTCCACAGTCAGTTTCA

Genome Location:Chr1:17970805..17970825
Precursor Coordinates:151..322
MFE:-66.9
MFEI:1
GC:39.18
Plant Homologs:

aly-miR172a;aly-miR172d;aly-miR172a*;aly-miR172c;aly-miR172b;ath-miR172c;ath-miR172b;ath-miR172a;ath-miR172d;sly-miR172b;sly-miR172a;vvi-miR172d;aqc-miR172a;bol-miR172b;bol-miR172a;csi-miR172a;csi-miR172b;gma-miR172f;gma-miR172b;gma-miR172a;zma-miR172d;zma-miR172a;zma-miR172b;zma-miR172c;ata-miR172;bra-miR172a;bra-miR172b;osa-miR172a;osa-miR1426;osa-miR172d;ptc-miR172a;ptc-miR172c;ptc-miR172b;ptc-miR172f;sbi-miR172d;sbi-miR172a;sbi-miR172c;

Structure:
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1276 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1543 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1657 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000252675 
Target Start:209 
Target End:229 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:270 
Target End:290 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000148472 
Target Start:423 
Target End:443 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAUAACUACUAUGAGGUU -5' 
Inhibition Type:Cleavage 
MDP0000148472 
Target:MDP0000321461 
Target Start:503 
Target End:523 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000285150 
Target Start:887 
Target End:907 
miRNA Aligned Fragment:5'-AGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000208739 
Target Start:320 
Target End:340 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCAC-3' 
Target Aligned Fragment:3'- AUUAAGAACUACGACGACGUG -5' 
Inhibition Type:Cleavage 
MDP0000208739 
Target:MDP0000170673 
Target Start:14 
Target End:33 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUUAGAACUACUAGGACUA -5' 
Inhibition Type:Cleavage 
MDP0000170673 
Target:MDP0000424651 
Target Start:1658 
Target End:1677 
miRNA Aligned Fragment:5'-UGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- ACUUAGAAGAACUACGACGG -5' 
Inhibition Type:Translation 
MDP0000424651 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested