AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172d

miR172d  

Mature Sequence:5'-GAATCTTGATGATGCTGCAG-3'

Precursor Sequence:

TGCAGCATCATCAAGATTCACATACCTTAGCAAGGGGGCTACCTTTAGCGATCGAGTAAA
TTGGTACCACACCAATATGAATATTCCTTCAACTTCCTTTTGTACTTGAAAGGTAGTTCC
TTCGAAGTGGGAATCTTGATGATGCTGCAG

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000181606 
Target Start:1250 
Target End:1269 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1275 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1542 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1656 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000285955 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000252675 
Target Start:209 
Target End:228 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000302021 
Target Start:515 
Target End:534 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UUUGGAACCGCUGCGACGUC -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000135349 
Target Start:270 
Target End:289 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000885666 
Target Start:503 
Target End:522 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- AUUAGAACUACUUCGACUUC -5' 
Inhibition Type:Cleavage 
MDP0000885666 
Target:MDP0000295594 
Target Start:437 
Target End:456 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- AUUAGAACUACUUCGACUUC -5' 
Inhibition Type:Cleavage 
MDP0000295594 
Target:MDP0000245462 
Target Start:503 
Target End:522 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- AUUAGAACUACUUCGACUUC -5' 
Inhibition Type:Cleavage 
MDP0000245462 
Target:MDP0000289283 
Target Start:503 
Target End:522 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- AUUAGAACUACUUCGACUUC -5' 
Inhibition Type:Cleavage 
MDP0000289283 
Target:MDP0000321461 
Target Start:503 
Target End:522 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000123673 
Target Start:955 
Target End:974 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UUUGGAACAACUAAGACGUC -5' 
Inhibition Type:Translation 
MDP0000123673 
Target:MDP0000285150 
Target Start:887 
Target End:906 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000285150 
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested