AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172e

miR172e  

Mature Sequence:5'-GGAATCTTGATGATGCTGCAGCAG-3'

Precursor Sequence:

GAGTGAGTCAGTATTCGCGGGTGCAGCATCATCAAGATTCACATACCTTAGCAAGGGGGC
TACCTTTAGCGATCGAGTAAATTGGTACCACACCAATATGAATATTCCTTCAACTTCCTT
TTGTACTTGAAAGGTAGTTRCTTCGAAGTGGGAATCTTGATGATGCTGCAGCAGCTGGTA
CATGACTATTTGGAATCGGCGCCGATGATCCCTGTGAAGAA

Genome Location:Chr3:7639596..7639573
Precursor Coordinates:179..400
MFE:-81.1
MFEI:0.82
GC:44.8
Plant Homologs:

aly-miR172d;aly-miR172c;ath-miR172c;ath-miR172d;ghr-miR172;vvi-miR172c;csi-miR172c;gma-miR172e;gma-miR172d;gma-miR172c;mtr-miR172;rco-miR172;bdi-miR172d;ptc-miR172g;ptc-miR172h;

Structure:
Target:MDP0000200319 
Target Start:1259 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000204900 
Target Start:1520 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000163645 
Target Start:1259 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCAUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000137561 
Target Start:1634 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUCGCC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000296716 
Target Start:1253 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUCAUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000130802 
Target Start:1286 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUUAUC -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000302021 
Target Start:512 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGUCUUC -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000181606 
Target Start:1250 
Target End:1269 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1275 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000200319 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1262 
Target End:1281 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1542 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1656 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- CUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000130613 
Target Start:405 
Target End:424 
miRNA Aligned Fragment:5'-GAAUCUUGAUGAUGCUGCAU-3' 
Target Aligned Fragment:3'- AUUAGAACUACUACAGUGUA -5' 
Inhibition Type:Cleavage 
MDP0000130613 
Target:MDP0000200319 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000285955 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000281079 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000130802 
Target Start:1290 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000163645 
Target Start:1263 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1638 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000181606 
Target Start:1251 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1257 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGU -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000302021 
Target Start:516 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGU -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000252675 
Target Start:210 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:271 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000506954 
Target Start:263 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGU -5' 
Inhibition Type:Cleavage 
MDP0000506954 
Target:MDP0000321461 
Target Start:504 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCA-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested