AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR172g

miR172g  

Mature Sequence:5'-GGAATCTTGATGATGCTGCAG-3'

Precursor Sequence:

AGTGAGTCAGTATTCGCGGGTGCAGCATCATCAAGATTCACATACCTTAGCAAGGGGGCT
ACCTTTAGCGATCGAGTAAATTGGTACCACACCAATATGAATATTCCTTCAACTTCCTTT
TGTACTTGAAAGGTAGTTYCTTCGAAGTGGGAATCTTGATGATGCTGCAGCAGCTGGTAC
ATGACTATTTGGAATCGGCGCCGATGATCCCTGTGAAGAAG

Genome Location:Chr3:7639596..7639576
Precursor Coordinates:176..397
MFE:-81.1
MFEI:0.82
GC:44.8
Plant Homologs:

aly-miR172a;aly-miR172d;aly-miR172c*;aly-miR172a*;aly-miR172c;aly-miR172b;aly-miR172b*;aly-miR172e;ath-miR172c;ath-miR172b;ath-miR172e;ath-miR172a;ath-miR172d;ghr-miR172;sly-miR172b;sly-miR172a;vvi-miR172a;vvi-miR172c;vvi-miR172d;vvi-miR172b;aqc-miR172b;aqc-miR172a;bol-miR172b;bol-miR172a;csi-miR172c;csi-miR172a;csi-miR172b;csi-miR172a*;gma-miR172e;gma-miR172f;gma-miR172d;gma-miR172b;gma-miR172c;gma-miR172a;mtr-miR172;rco-miR172;zma-miR172d;zma-miR172a;zma-miR172e;zma-miR172b;zma-miR172b*;zma-miR172c;zma-miR172d*;ata-miR172;bdi-miR172d;bra-miR172a;bra-miR172b;osa-miR172b;osa-miR172a;osa-miR172d;osa-miR172c;ptc-miR172a;ptc-miR172g;ptc-miR172e;ptc-miR172c;ptc-miR172b;ptc-miR172h;ptc-miR172f;ptc-miR172d;sbi-miR172e;sbi-miR172b;sbi-miR172d;sbi-miR172a;sbi-miR172c;

Structure:
Target:MDP0000200319 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000200319 
Target:MDP0000163645 
Target Start:1262 
Target End:1282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000163645 
Target:MDP0000204900 
Target Start:1523 
Target End:1543 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000204900 
Target:MDP0000137561 
Target Start:1637 
Target End:1657 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000137561 
Target:MDP0000181606 
Target Start:1250 
Target End:1270 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000181606 
Target:MDP0000296716 
Target Start:1256 
Target End:1276 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACGACGUC -5' 
Inhibition Type:Cleavage 
MDP0000296716 
Target:MDP0000285955 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000285955 
Target:MDP0000130802 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000130802 
Target:MDP0000281079 
Target Start:1289 
Target End:1309 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CCUUAGGACUACUACGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000281079 
Target:MDP0000302021 
Target Start:515 
Target End:535 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACCGCUGCGACGUC -5' 
Inhibition Type:Translation 
MDP0000302021 
Target:MDP0000252675 
Target Start:209 
Target End:229 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUC -5' 
Inhibition Type:Cleavage 
MDP0000252675 
Target:MDP0000135349 
Target Start:270 
Target End:290 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGAAUUACUACGGUUUU -5' 
Inhibition Type:Cleavage 
MDP0000135349 
Target:MDP0000123673 
Target Start:955 
Target End:975 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGUC -5' 
Inhibition Type:Translation 
MDP0000123673 
Target:MDP0000506954 
Target Start:262 
Target End:282 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUAGAACUAAUGAGACGUU -5' 
Inhibition Type:Cleavage 
MDP0000506954 
Target:MDP0000321461 
Target Start:503 
Target End:523 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- UCUUAGGACUACUACUACUUU -5' 
Inhibition Type:Cleavage 
MDP0000321461 
Target:MDP0000138865 
Target Start:862 
Target End:882 
miRNA Aligned Fragment:5'-GGAAUCUUGAUGAUGCUGCAG-3' 
Target Aligned Fragment:3'- CUUUGGAACAACUAAGACGUU -5' 
Inhibition Type:Translation 
MDP0000138865 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested