AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR1814

miR1814  

Mature Sequence:5'-AGGTTGTTTGGTTTTGTTTT-3'

Precursor Sequence:

_

Genome Location:Chr13:19745743..19745762
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000171742 
Target Start:384 
Target End:403 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAACAAAAACAAAA -5' 
Inhibition Type:Translation 
MDP0000171742 
Target:MDP0000292326 
Target Start:56 
Target End:75 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAACUAAAACAGGA -5' 
Inhibition Type:Cleavage 
MDP0000292326 
Target:MDP0000369858 
Target Start:471 
Target End:490 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- ACCAACAAACCGAGACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000369858 
Target:MDP0000131094 
Target Start:670 
Target End:689 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACGAACCAAAACUAAA -5' 
Inhibition Type:Cleavage 
MDP0000131094 
Target:MDP0000143585 
Target Start:703 
Target End:722 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACGAACCAAAACUAAA -5' 
Inhibition Type:Cleavage 
MDP0000143585 
Target:MDP0000123086 
Target Start:1360 
Target End:1379 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAAACCAAAGCAGUG -5' 
Inhibition Type:Cleavage 
MDP0000123086 
Target:MDP0000161558 
Target Start:209 
Target End:228 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUCAACAAAUCGAAGCAAAC -5' 
Inhibition Type:Cleavage 
MDP0000161558 
Target:MDP0000247495 
Target Start:5654 
Target End:5673 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- CUCAACGAACCAAAAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000247495 
Target:MDP0000282171 
Target Start:337 
Target End:356 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAAUAUAUCAAAACGAAA -5' 
Inhibition Type:Cleavage 
MDP0000282171 
Target:MDP0000724726 
Target Start:977 
Target End:996 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCGACCAGCCAGAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000724726 
Target:MDP0000147266 
Target Start:952 
Target End:971 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAAAUCAAAGUAUAA -5' 
Inhibition Type:Cleavage 
MDP0000147266 
Target:MDP0000217823 
Target Start:1493 
Target End:1512 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UUUGACGAACUAAAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000217823 
Target:MDP0000296541 
Target Start:2120 
Target End:2139 
miRNA Aligned Fragment:5'-AGGUUGUUUGGUUUUGUUUU-3' 
Target Aligned Fragment:3'- UCCAACAACUCGAAACAAAG -5' 
Inhibition Type:Translation 
MDP0000296541 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested