AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR1888

miR1888  

Mature Sequence:5'-GAAGTTAAGATTTGGGCAGAA-3'

Precursor Sequence:

_

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000227056 
Target Start:124 
Target End:144 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGAA-3' 
Target Aligned Fragment:3'- CUUCAAUUCUAGGCCUCUCUU -5' 
Inhibition Type:Cleavage 
MDP0000227056 
Target:MDP0000672454 
Target Start:322 
Target End:342 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGAA-3' 
Target Aligned Fragment:3'- UUUCAAUUUUAGACGUGUCUU -5' 
Inhibition Type:Cleavage 
MDP0000672454 
Target:MDP0000453000 
Target Start:124 
Target End:144 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGAA-3' 
Target Aligned Fragment:3'- UUUCAAUUCUAGGCCUCUCUU -5' 
Inhibition Type:Cleavage 
MDP0000453000 
Target:MDP0000164680 
Target Start:268 
Target End:287 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUCU -5' 
Inhibition Type:Cleavage 
MDP0000164680 
Target:MDP0000206825 
Target Start:344 
Target End:363 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUCU -5' 
Inhibition Type:Cleavage 
MDP0000206825 
Target:MDP0000282668 
Target Start:1058 
Target End:1077 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAAUUCUAAACCUAUUU -5' 
Inhibition Type:Cleavage 
MDP0000282668 
Target:MDP0000487715 
Target Start:1649 
Target End:1668 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUCU -5' 
Inhibition Type:Cleavage 
MDP0000487715 
Target:MDP0000226302 
Target Start:3198 
Target End:3217 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUCAACUCUAAGUUCGUCU -5' 
Inhibition Type:Cleavage 
MDP0000226302 
Target:MDP0000220742 
Target Start:704 
Target End:723 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUUU -5' 
Inhibition Type:Cleavage 
MDP0000220742 
Target:MDP0000315321 
Target Start:743 
Target End:762 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUUU -5' 
Inhibition Type:Cleavage 
MDP0000315321 
Target:MDP0000213393 
Target Start:1667 
Target End:1686 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUUU -5' 
Inhibition Type:Cleavage 
MDP0000213393 
Target:MDP0000295496 
Target Start:878 
Target End:897 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUUU -5' 
Inhibition Type:Cleavage 
MDP0000295496 
Target:MDP0000578465 
Target Start:1033 
Target End:1052 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUCGAUUUUAAACUUUUCU -5' 
Inhibition Type:Cleavage 
MDP0000578465 
Target:MDP0000247940 
Target Start:125 
Target End:144 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- UUUCAAUUCUAGGCCUCUCU -5' 
Inhibition Type:Cleavage 
MDP0000247940 
Target:MDP0000197951 
Target Start:1211 
Target End:1230 
miRNA Aligned Fragment:5'-GAAGUUAAGAUUUGGGCAGA-3' 
Target Aligned Fragment:3'- CUUUAGUUCUAAACCUAUUU -5' 
Inhibition Type:Cleavage 
MDP0000197951 
Data resource:
Huaping Yu et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested