AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR2109

miR2109  

Mature Sequence:5'-TGCGAGTGTCTTCGCCTCTG-3'

Precursor Sequence:

_

Genome Location:Chr1:24617700..24617681
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000378930 
Target Start:612 
Target End:631 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000378930 
Target:MDP0000314565 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000314565 
Target:MDP0000410502 
Target Start:81 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000410502 
Target:MDP0000605598 
Target Start:168 
Target End:187 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000605598 
Target:MDP0000433167 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000433167 
Target:MDP0000222077 
Target Start:93 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000222077 
Target:MDP0000317856 
Target Start:81 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGRAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000317856 
Target:MDP0000220580 
Target Start:93 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000220580 
Target:MDP0000193014 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000193014 
Target:MDP0000277868 
Target Start:63 
Target End:82 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000277868 
Target:MDP0000400164 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000400164 
Target:MDP0000278543 
Target Start:822 
Target End:841 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000278543 
Target:MDP0000661138 
Target Start:453 
Target End:472 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCAUAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000661138 
Target:MDP0000601632 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000601632 
Target:MDP0000946278 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000946278 
Target:MDP0000297707 
Target Start:1719 
Target End:1738 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- GCGCUCACAGAAGUGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000297707 
Target:MDP0000216668 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000216668 
Target:MDP0000637513 
Target Start:579 
Target End:598 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGYGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000637513 
Target:MDP0000150743 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAU -5' 
Inhibition Type:Cleavage 
MDP0000150743 
Target:MDP0000724111 
Target Start:87 
Target End:106 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCACACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000724111 
Target:MDP0000634037 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAUGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000634037 
Target:MDP0000694809 
Target Start:66 
Target End:85 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000694809 
Target:MDP0000525273 
Target Start:60 
Target End:79 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000525273 
Target:MDP0000506162 
Target Start:51 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000506162 
Target:MDP0000458576 
Target Start:75 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUG-3' 
Target Aligned Fragment:3'- ACGCGCACAGAAGCGGAGAC -5' 
Inhibition Type:Cleavage 
MDP0000458576 
Target:MDP0000378930 
Target Start:611 
Target End:631 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000378930 
Target:MDP0000314565 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000314565 
Target:MDP0000410502 
Target Start:80 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000410502 
Target:MDP0000605598 
Target Start:167 
Target End:187 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000605598 
Target:MDP0000433167 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000433167 
Target:MDP0000222077 
Target Start:92 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000222077 
Target:MDP0000317856 
Target Start:80 
Target End:100 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGRAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000317856 
Target:MDP0000220580 
Target Start:92 
Target End:112 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGCGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000220580 
Target:MDP0000193014 
Target Start:74 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000193014 
Target:MDP0000277868 
Target Start:62 
Target End:82 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000277868 
Target:MDP0000400164 
Target Start:74 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000400164 
Target:MDP0000278543 
Target Start:821 
Target End:841 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGGAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000278543 
Target:MDP0000661138 
Target Start:452 
Target End:472 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCAUAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000661138 
Target:MDP0000601632 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000601632 
Target:MDP0000946278 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- AUGCUCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000946278 
Target:MDP0000297707 
Target Start:1718 
Target End:1738 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- GCGCUCACAGAAGUGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000297707 
Target:MDP0000216668 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000216668 
Target:MDP0000637513 
Target Start:578 
Target End:598 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGYGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000637513 
Target:MDP0000150743 
Target Start:83 
Target End:103 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGUGGAGAUU -5' 
Inhibition Type:Cleavage 
MDP0000150743 
Target:MDP0000724111 
Target Start:86 
Target End:106 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCACACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000724111 
Target:MDP0000634037 
Target Start:50 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAUGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000634037 
Target:MDP0000694809 
Target Start:65 
Target End:85 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000694809 
Target:MDP0000525273 
Target Start:59 
Target End:79 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000525273 
Target:MDP0000506162 
Target Start:50 
Target End:70 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCUCACAGAAGGGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000506162 
Target:MDP0000458576 
Target Start:74 
Target End:94 
miRNA Aligned Fragment:5'-UGCGAGUGUCUUCGCCUCUGA-3' 
Target Aligned Fragment:3'- ACGCGCACAGAAGCGGAGACU -5' 
Inhibition Type:Cleavage 
MDP0000458576 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested