AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR2111a

miR2111a  

Mature Sequence:5'-TAATCTGCATCCTGAGGTTTA-3'

Precursor Sequence:

ATATTGGGTTAGGATTGGGTAATCTGCATCCTGAGGTTTAGATCAGCACACACGTATTTG
TTGTATCTAGTCCTTGGGATGCAGATTACCTTGTCCTTGCCGCCAATGCAAGAAGACTTG
TTAAGCTCATGAGTCATGAGGCTACTACTTAATGCATGTTTTKATTCTTTT

Genome Location:Chr12:22254664..22254644
Precursor Coordinates:181..352
MFE:-70.4
MFEI:1.02
GC:40.35
Plant Homologs:

aly-miR2111b;aly-miR2111a;ath-miR2111b;ath-miR2111a;bna-miR2111b;bna-miR2111a;vvi-miR2111;mtr-miR2111e;mtr-miR2111m;mtr-miR2111b;mtr-miR2111s;mtr-miR2111r;mtr-miR2111d;mtr-miR2111i;mtr-miR2111o;mtr-miR2111n;mtr-miR2111q;mtr-miR2111h;mtr-miR2111c;mtr-miR2111k;mtr-miR2111a;mtr-miR2111p;mtr-miR2111j;mtr-miR2111f;mtr-miR2111l;bra-miR2111a;bra-miR2111b;lja-miR2111;lja-miR2111*;

Structure:
Target:MDP0000892979 
Target Start:198 
Target End:218 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000892979 
Target:MDP0000417953 
Target Start:198 
Target End:218 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000417953 
Target:MDP0000895750 
Target Start:219 
Target End:239 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUUAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000895750 
Target:MDP0000399538 
Target Start:228 
Target End:248 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUUA-3' 
Target Aligned Fragment:3'- AUCAGACGUAGGACGCCAAAU -5' 
Inhibition Type:Cleavage 
MDP0000399538 
Target:MDP0000125891 
Target Start:105 
Target End:124 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUGAGGUGUAGGACUCCAAA -5' 
Inhibition Type:Cleavage 
MDP0000125891 
Target:MDP0000200895 
Target Start:814 
Target End:833 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- UUUAGACGUUGGACUCGAAA -5' 
Inhibition Type:Translation 
MDP0000200895 
Target:MDP0000332753 
Target Start:222 
Target End:241 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- AUUAGACGUGGGAUUAGAAA -5' 
Inhibition Type:Cleavage 
MDP0000332753 
Target:MDP0000254078 
Target Start:202 
Target End:221 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
MDP0000254078 
Target:MDP0000154994 
Target Start:670 
Target End:689 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
MDP0000154994 
Target:MDP0000190060 
Target Start:733 
Target End:752 
miRNA Aligned Fragment:5'-UAAUCUGCAUCCUGAGGUUU-3' 
Target Aligned Fragment:3'- GUUAGACGUUGGACUUGAAA -5' 
Inhibition Type:Translation 
MDP0000190060 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested