AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR2275a

miR2275a  

Mature Sequence:5'-TTTGGTTTCCTCCAATATCTCA-3'

Precursor Sequence:

TCCAAATCAATTCAACATTTCATTGTTGTTTTAAAAGCCGTATGTAAGAATTGGAGGGGA
CTAAACAAAATCAAATTACACCGGGGAATTCTTACTTTGTTTGGTTTCCTCCAATATCTC
ATTTCCGGCTTTAAAAGCCATATTTGAGAATAGGAGAGGGCTAAACAAATTA

Genome Location:Chr17:3389671..3389650
Precursor Coordinates:101..273
MFE:-47.6
MFEI:0.81
GC:34.3
Plant Homologs:

zma-miR2275a-3p;osa-miR2275b;osa-miR2275a;

Structure:
Target:MDP0000946566 
Target Start:537 
Target End:558 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCUCA-3' 
Target Aligned Fragment:3'- UAGUCAAGGGGGGUUAUAGAGU -5' 
Inhibition Type:Cleavage 
MDP0000946566 
Target:MDP0000052608 
Target Start:881 
Target End:900 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCGAAGGAGGUGAUAGA -5' 
Inhibition Type:Cleavage 
MDP0000052608 
Target:MDP0000052605 
Target Start:881 
Target End:900 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCGAAGGAGGUGAUAGA -5' 
Inhibition Type:Cleavage 
MDP0000052605 
Target:MDP0000247791 
Target Start:881 
Target End:900 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCGAAGGAGGUGAUAGA -5' 
Inhibition Type:Cleavage 
MDP0000247791 
Target:MDP0000176025 
Target Start:1442 
Target End:1461 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCAGAGGAGGUUCUAGA -5' 
Inhibition Type:Cleavage 
MDP0000176025 
Target:MDP0000832627 
Target Start:687 
Target End:708 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCUCA-3' 
Target Aligned Fragment:3'- AAGCUAAACGAAGUUAUAGAGU -5' 
Inhibition Type:Translation 
MDP0000832627 
Target:MDP0000226644 
Target Start:959 
Target End:978 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCGGAGGAGGUUCUAGA -5' 
Inhibition Type:Cleavage 
MDP0000226644 
Target:MDP0000225492 
Target Start:1163 
Target End:1182 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCRGAGGAGGUUCUAGA -5' 
Inhibition Type:Cleavage 
MDP0000225492 
Target:MDP0000455984 
Target Start:1586 
Target End:1605 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCGAAGGAGGUUGAAGA -5' 
Inhibition Type:Cleavage 
MDP0000455984 
Target:MDP0000844205 
Target Start:1022 
Target End:1042 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCUC-3' 
Target Aligned Fragment:3'- AAACUAAAGGAGGUUAUUUAG -5' 
Inhibition Type:Cleavage 
MDP0000844205 
Target:MDP0000247672 
Target Start:824 
Target End:844 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCUC-3' 
Target Aligned Fragment:3'- AAACCAAAGGAGGUUCAGGAG -5' 
Inhibition Type:Cleavage 
MDP0000247672 
Target:MDP0000435532 
Target Start:185 
Target End:204 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCAGAGGAGGUUAUGAC -5' 
Inhibition Type:Cleavage 
MDP0000435532 
Target:MDP0000145543 
Target Start:230 
Target End:249 
miRNA Aligned Fragment:5'-UUUGGUUUCCUCCAAUAUCU-3' 
Target Aligned Fragment:3'- AAACCAGAGGAGGUUAUGAC -5' 
Inhibition Type:Cleavage 
MDP0000145543 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested