AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR2444

miR2444  

Mature Sequence:5'-TTTGTGTTGTTTTTTGTTTT-3'

Precursor Sequence:

_

Genome Location:Chr7:21435905..21435924
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000121883 
Target Start:1175 
Target End:1194 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACACAACAAAGAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000121883 
Target:MDP0000272633 
Target Start:59 
Target End:78 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCAAAAAGUAAAA -5' 
Inhibition Type:Cleavage 
MDP0000272633 
Target:MDP0000584547 
Target Start:1733 
Target End:1752 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACGCAACAAAAAACAAAC -5' 
Inhibition Type:Cleavage 
MDP0000584547 
Target:MDP0000221576 
Target Start:1913 
Target End:1932 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACGCAACAAAAAAGAAAA -5' 
Inhibition Type:Cleavage 
MDP0000221576 
Target:MDP0000144996 
Target Start:2555 
Target End:2574 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACGCAACAAAAAAGAAAA -5' 
Inhibition Type:Cleavage 
MDP0000144996 
Target:MDP0000140336 
Target Start:738 
Target End:757 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACGACAAGAAGCAAAC -5' 
Inhibition Type:Cleavage 
MDP0000140336 
Target:MDP0000161311 
Target Start:98 
Target End:117 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACAAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000161311 
Target:MDP0000358759 
Target Start:536 
Target End:555 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACAUAACGAAAAAUAAAG -5' 
Inhibition Type:Cleavage 
MDP0000358759 
Target:MDP0000607252 
Target Start:327 
Target End:346 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AGACAAAACAAAAAACGAAA -5' 
Inhibition Type:Cleavage 
MDP0000607252 
Target:MDP0000568244 
Target Start:514 
Target End:533 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000568244 
Target:MDP0000225718 
Target Start:869 
Target End:888 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- GAACACAACGAAGAAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000225718 
Target:MDP0000920266 
Target Start:1033 
Target End:1052 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000920266 
Target:MDP0000739959 
Target Start:599 
Target End:618 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAGAAUCAAA -5' 
Inhibition Type:Cleavage 
MDP0000739959 
Target:MDP0000459146 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000459146 
Target:MDP0000131142 
Target Start:1324 
Target End:1343 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAACAUGAAA -5' 
Inhibition Type:Cleavage 
MDP0000131142 
Target:MDP0000300139 
Target Start:908 
Target End:927 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCGAAAGGUAAAA -5' 
Inhibition Type:Cleavage 
MDP0000300139 
Target:MDP0000130320 
Target Start:866 
Target End:885 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAGCGAAAGGUAAAA -5' 
Inhibition Type:Cleavage 
MDP0000130320 
Target:MDP0000213799 
Target Start:2389 
Target End:2408 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACAUAAGAAAAAGCAAAA -5' 
Inhibition Type:Translation 
MDP0000213799 
Target:MDP0000703418 
Target Start:16 
Target End:35 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAAUACGACGGGAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000703418 
Target:MDP0000297746 
Target Start:394 
Target End:413 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACACAACAAAAGGCUAAA -5' 
Inhibition Type:Cleavage 
MDP0000297746 
Target:MDP0000350586 
Target Start:181 
Target End:200 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACGAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000350586 
Target:MDP0000144055 
Target Start:471 
Target End:490 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- UAACACUACAAAAAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000144055 
Target:MDP0000347536 
Target Start:68 
Target End:87 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AACCAAAACAAAAAACAAAA -5' 
Inhibition Type:Cleavage 
MDP0000347536 
Target:MDP0000347699 
Target Start:39 
Target End:58 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAACAAAAUAAAAGACAGAA -5' 
Inhibition Type:Cleavage 
MDP0000347699 
Target:MDP0000206902 
Target Start:189 
Target End:208 
miRNA Aligned Fragment:5'-UUUGUGUUGUUUUUUGUUUU-3' 
Target Aligned Fragment:3'- AAGCACGGCGAAGAACGAAA -5' 
Inhibition Type:Cleavage 
MDP0000206902 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested