AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR319a

miR319a  

Mature Sequence:5'-TTGGACTGAAGGGAGCTCCCT-3'

Precursor Sequence:

CCTCTTCTCTTTTCTCGGCTATATTCGTGCGAAAATTGCAGAAATGGGAGTTCCATGCAG
CCCAAACCAGCGGCTATGAATAAAATAGTAGCTCTATGTTTTGGACTGAAGGGAGCTCCC
AATTCTTCTATTTTCTTTCCTTGATAAGGGACTTACAGCCAAAACAGTTTA

Genome Location:Chr3:4458733..4458713
Precursor Coordinates:100..271
MFE:-56.5
MFEI:0.8
GC:41.52
Plant Homologs:

vvi-miR319e;aqc-miR159;csi-miR319;

Structure:
Target:MDP0000442611 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000162193 
Target Start:1038 
Target End:1058 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUACCUUGGAGGA -5' 
Inhibition Type:Translation 
MDP0000162193 
Target:MDP0000186465 
Target Start:377 
Target End:396 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000186465 
Target:MDP0000216976 
Target Start:422 
Target End:441 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GGAUCUGACUUCCCUCGACA -5' 
Inhibition Type:Cleavage 
MDP0000216976 
Target:MDP0000253886 
Target Start:723 
Target End:742 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000253886 
Target:MDP0000308617 
Target Start:1089 
Target End:1108 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCAAACUUCCCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000308617 
Target:MDP0000237596 
Target Start:101 
Target End:120 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000237596 
Target:MDP0000319634 
Target Start:587 
Target End:606 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUAGCUUACCUCGAGG -5' 
Inhibition Type:Cleavage 
MDP0000319634 
Target:MDP0000265425 
Target Start:418 
Target End:437 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
MDP0000265425 
Target:MDP0000229368 
Target Start:798 
Target End:817 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACGUGACUUUCCUAGAGG -5' 
Inhibition Type:Cleavage 
MDP0000229368 
Target:MDP0000262512 
Target Start:254 
Target End:273 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUGAAUUUCUUCUAGG -5' 
Inhibition Type:Translation 
MDP0000262512 
Target:MDP0000162193 
Target Start:1040 
Target End:1059 
miRNA Aligned Fragment:5'-CUUGGACUGAAGGGAGCUCC-3' 
Target Aligned Fragment:3'- GAACCUGACUUACCUUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000162193 
Data resource:
microPC
mirNEST
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested